Outline
Figures

Volume: 3

Issue: 1

Page: 13-19

ISSN: 3079-5346

Prevalence, molecular detection, and antimicrobial resistance profiles of Staphylococcus aureus and Escherichia coli in raw milk from urban milk markets of southwestern Bangladesh

Partha Pratim Ghosh1,2,* ORCIDMd. Bakhtiar Lijon3ORCIDMd. Mosharraf Hossen1ORCIDSheben Chandra Liton4ORCIDEsrat Jahan5ORCIDUmmay Sumya Julia Jami5ORCIDDebasree Saha6ORCIDMd. Al-Amin Sarker6ORCIDMd Shiblee Sadik Sabuj7ORCIDMd Jamilur Rahman8ORCIDTanvir Ahmed5ORCID
Show More ▼

1 Department of Biotechnology & Genetic Engineering, Islamic University, Kushtia-7003, Bangladesh

2 School of Engineering Technology and Applied Science (Biotechnology), Cenetennial College, 755 Morningside Ave, Scarborough, ON M1C 4Z4, Canada

3 Graduate School of Environmental and Life Science, Okayama University, Okayama 7008530, Japan

4 Department of Surgery and Obstetrics, Bangladesh Agricultural University, Mymensingh – 2202, Bangladesh

5 Faculty of Veterinary Medicine, Jashore University of Science and Technology, Jashore-7408, Bangladesh

6 Department of Dairy and Poultry Science, Gazipur Agricultural University, Gazipur-1706, Bangladesh

7 College of Veterinary Medicine and Institute of Animal Transplantation, Jeonbuk National University, Iksan, Jeollabuk-do 54596, Republic of Korea

8 Laboratory of Veterinary Pathology, College of Veterinary Medicine Kangwon National University, Kangwondaehak-gil, Chuncheon-si, Gangwon-do, 24341, Republic of Korea

 

*Corresponding author
Email address: p.pratim.g.103307@gmail.com

 

doi: https://doi.org/10.69517/jber.2026.03.01.0003

Share:

Received:
15 November, 2025

Revised:
7 January, 2026

Accepted:
23 February, 2026

Published:
30 March, 2026

  • Raw milk from Kushtia Sadar, Bangladesh, showed significant bacterial contamination upon analysis.
  • Staphylococcus aureus and Escherichia coli were detected in a substantial proportion of samples.
  • Molecular assays confirmed key genetic markers (nuc gene in aureus and 16S rRNA in E. coli).
  • Both pathogens exhibited notable antibiotic resistance, particularly to commonly used drugs.
  • Raw milk represents a potential reservoir of antibiotic-resistant bacteria, posing a public health risk.

Abstract

Raw milk is widely consumed in Bangladesh; however, poor hygienic conditions during milking, handling, and marketing may lead to contamination with pathogenic bacteria, posing potential risks to public health. This study aimed to isolate, identify, and molecularly detect Staphylococcus aureus and Escherichia coli from raw milk samples sold in Kushtia Sadar, Bangladesh. A total of 90 raw milk samples were aseptically collected from various local markets in Kushtia Sadar. The samples were examined for the isolation and identification of the target bacteria using cultural characteristics, Gram staining, biochemical tests, and molecular techniques. Molecular confirmation of S. aureus was performed by amplifying the nuc gene, while E. coli was detected using PCR targeting the 16S rRNA gene. Among the 90 samples, 35 (95% CI: 28.8%–49.0%; p = 0.031) were culture-positive for S. aureus, and 20 (95% CI: 13.6%–30.8%; p = 0.001) were culture-positive for E. coli. Molecular analysis revealed that 16 of the S. aureus isolates (45.7%, 95% CI: 29.2%–62.2%; p = 0.61) were positive for the nuc gene, while 9 of the E. coli isolates (45.0%, 95% CI: 23.2%–66.8%; p = 0.65) carried the 16S rRNA gene. The antibiogram profiles showed that most nuc gene-positive S. aureus isolates were highly resistant to vancomycin (50%), penicillin (100%), cefoxitin (100%), and oxacillin (100%), but exhibited high sensitivity to levofloxacin, norfloxacin, and doxycycline (100%). In contrast, the 16S rRNA gene–positive E. coli isolates demonstrated high resistance to ampicillin (100%) and cotrimoxazole (44.44%). The highest sensitivity was observed against gentamicin and nitrofurantoin (88.88%), while the lowest sensitivity was recorded for ampicillin (0%) and cefotaxime (11.11%). The findings of this study indicate that raw milk sold in Kushtia Sadar may serve as a potential reservoir for pathogenic and antibiotic-resistant bacteria, posing significant public health risks if consumed without proper processing.

Graphical Abstract

Keywords

Antibiogram, nuc gene, 16S rRNA, PCR, Raw milk, Public health

1. Introduction

Milk is the fresh mammary secretion obtained from dairy animals and is one of the most widely consumed and nutritionally valuable foods for humans and newborn animals (Bruckmaier and Zinn, 2023). It provides essential macronutrients and micronutrients, including proteins, fats, carbohydrates, vitamins, and minerals, which support growth, development, and overall health (Roy et al., 2020). Milk is considered a complete food and is recommended as a major component of the daily diet. Its composition includes water (87.2%), protein (3.5%), fat (3.7%), lactose (4.9%), ash (0.7%), and dry matter (12.8%) (Górska-Warsewicz et al., 2019). These constituents not only support human nutrition but also contribute to the functional and technological properties of dairy products, with proteins aiding in cheese and yogurt processing, lactose providing energy, fat contributing to flavor and texture, and minerals and vitamins supporting metabolic and bone health (Pokala et al., 2024).

Despite its high nutritional value, milk provides an ideal environment for microbial growth due to its nutrients, neutral pH, and high moisture content. It is susceptible to contamination during production, processing, storage, and distribution (Aydogdu et al., 2023; Dash et al., 2022). Pathogens such as Staphylococcus aureus, Escherichia coli, Salmonella spp., and Listeria spp. in raw or improperly processed milk can cause gastrointestinal and systemic illnesses, posing significant health risks, particularly to children, the elderly, and immunocompromised individuals (Subedi et al., 2025).

Bacterial contamination of milk is influenced by several factors during the milking and handling process. Contamination can occur from the farm environment, including soil, water, and feed, or from infected animals suffering from mastitis (Yu et al., 2025). Poor sanitation of milking equipment, unclean storage containers, and unhygienic handling practices by milkers can contribute to an increased microbial load (Singh and Ramachandran, 2020). Microorganisms may also enter the udder through the teat canal, especially in animals with subclinical or clinical mastitis, allowing pathogens to contaminate the milk directly (Tommasoni et al., 2023). Consequently, the microbial quality of milk is strongly dependent on farm management practices, personnel hygiene, and adherence to standard operating procedures during milking and storage (Gebremichael et al., 2024). In addition to these on-farm factors, post-harvest handling—such as transportation in non-refrigerated containers, exposure to ambient temperatures, and delayed processing—further promotes bacterial growth, increasing the likelihood of milk borne infections (Darwesh et al., 2025; Rana et al., 2024).

S. aureus and E. coli are major contaminants of milk with significant public health implications (Hossain et al., 2024; Elmonir et al., 2018). S. aureus, a Gram-positive bacterium that produces virulence factors and enterotoxins, causes mastitis in dairy animals, affecting milk quality and can be directly shed into milk, reflecting both animal health and milking hygiene (Touaitia et al., 2025; Rawat et al., 2024). E. coli, a Gram-negative bacterium normally found in the intestines, can contaminate milk through fecal matter, with pathogenic strains causing severe gastrointestinal illness. Both pathogens are important indicators of milk safety and hygiene, posing risks especially where raw milk is widely consumed (Loor-Giler et al., 2025; Sarba et al., 2023).

E. coli is a Gram-negative, rod-shaped bacterium belonging to the family Enterobacteriaceae. It is a normal inhabitant of the intestinal tracts of humans and warm-blooded animals and is frequently used as an indicator of fecal contamination in food and water (Elbarbary et al., 2025; Martinson and Walk, 2020). While most strains of E. coli are non-pathogenic commensals, certain pathogenic strains, including Shiga toxin-producing E. coli (STEC), enterotoxigenic, and enterohemorrhagic strains, can cause severe gastrointestinal infections, hemorrhagic colitis, and hemolytic uremic syndrome in humans (Pokharel et al., 2023). Milk contamination with E. coli primarily occurs through fecal matter during milking, handling, or transportation, often exacerbated by poor sanitation practices and inadequate hygiene of personnel and equipment (Altaie et al., 2025; Sarba et al., 2023).

Several studies conducted in Bangladesh have documented the presence of pathogenic E. coli in fecal samples from cattle, raw milk, and dairy products, indicating that milk can serve as a reservoir for these pathogens (Hasan et al., 2023; Sultana et al., 2021; Islam et al., 2016). It is estimated that approximately 20% of diarrheal cases in Bangladesh are associated with enterotoxigenic E. coli (Chakraborty et al., 2024). The widespread presence of these bacteria in milk and dairy products underscores the potential risk to consumers, especially when milk is consumed without proper heat treatment or pasteurization.

The emergence of antimicrobial-resistant bacteria is a growing global public health concern. Antibiotic use in food-producing animals has contributed to resistance in pathogens such as S. aureus and E. coli, which have been detected in milk and dairy products, posing risks to both animal health and human consumers, particularly where unpasteurized milk is commonly consumed (Kaur et al., 2024; Salam et al., 2023).

Given milk’s nutritional importance and the risks of microbial contamination and antibiotic resistance, monitoring pathogenic bacteria in raw milk is essential for food safety. In Bangladesh, the informal marketing of raw milk often lacks proper hygiene and quality control, increasing the risk of contamination with S. aureus, E. coli, and other pathogens. This study was conducted to investigate the isolation, molecular detection, and antibiotic susceptibility of S. aureus and E. coli in raw milk from Kushtia Sadar, providing baseline data to guide safer dairy production and consumption practices.

2. Materials and Methods

2.1 Ethical approval statement

No ethical approval is required for this study.

2.2 Collection of samples

A total of 90 milk samples (n = 90) were collected from local markets in Kushtia Sadar Kushtia, Bangladesh. Up to 10 ml of raw milk was aseptically collected from retail markets using a sterile falcon tube. All samples were placed in an ice box at 4 °C and transported to the Department of Biotechnology and Genetic Engineering at Islamic University-7003, Kushtia, Bangladesh for bacteriological analysis.

Figure 1. Map of the study area.

Figure 1. Map of the study area.

2.3 Sample process and Isolation of S. aureus and E. coli

Immediately after collection, 1 mL of raw milk was transferred into 9 mL of Tryptic Soy Broth (TSB) and Nutrient Broth (NB) and incubated at 37°C for 24 hours for enrichment. A loopful of the enriched culture was streaked onto MSA agar and incubated at 37°C for 24 hours, followed by sub-culturing on MSA to obtain pure colonies of S. aureus (Cheesbrough, 1985). Similarly, the enriched culture was streaked onto MacConkey agar and incubated at 37 °C for 24 hours, then sub-cultured onto EMB agar and incubated at 37 °C for 24 hours to obtain pure colonies of E. coli (Cheesbrough, 1985).

2.4 Identification of S. aureus and E. coli

The identification of S. aureus and E. coli was conducted by observing cultural characteristics and colony morphology on MSA, MacConkey (MAC), and EMB agar. Confirmation was achieved through Gram staining and biochemical tests, including catalase and coagulase tests for S. aureus, as well as MR–VP and indole tests for E. coli.

2.5 Molecular identification of S. aureus and E. coli by PCR

2.5.1 Extraction of DNA from S. aureus and E. coli

The genomic DNA from all suspected S. aureus and E. coli isolates was extracted using a simple boiling method (Loberiza et al., 2025; Bose et al., 2025). Briefly, a single pure colony was inoculated in nutrient broth, and all broth cultures were incubated at 37 °C for 24 hours. Then, 1 ml of the cultured broth was transferred to an Eppendorf tube and centrifuged at 10,000 rpm for 5 minutes. The supernatant was discarded, and the pellet was re-suspended in 1 ml of sterile distilled water. The Eppendorf tube was vortexed and centrifuged again. The supernatant was discarded, and the pellet was re-suspended in 100 μl of deionized distilled water. The tubes were placed in boiling water for 15 minutes and then immediately transferred to ice for 10 minutes to induce cold shock. The tube was vortexed again and centrifuged at 10,000 rpm for 10 minutes. Finally, the supernatant was collected as a source of template DNA for PCR and stored at -20 °C for future use.

A final reaction mixture of 20 μl was used for all PCR experiments, comprising 3 μl of nuclease-free water, 10 μl of master mix (Promega, Madison, WI), 1 μl each of forward and reverse primers, and 5 μl of DNA template. After amplification, the PCR results were analyzed by electrophoresis on a 1.5% agarose gel. The gel was stained with ethidium bromide and documented using a Biometra UV transilluminator (Göttingen, Germany). A 100-bp DNA ladder (Promega, Madison, WI) was used as a reference marker to confirm the anticipated size of the amplified PCR products.

A gene-specific PCR assay was performed to detect the specific genes associated with S. aureusand E. coli. The assay successfully amplified the nuc and 16S rRNA genes using the PCR technique. The oligonucleotide primers used in this study for detecting these genes in S. aureusare listed in Table 1.

Table 1. Oligonucleotide primer sequences for detection of Staphylococcus aureus and Escherichia coli.

Target gene Primer sequences (5‘-3‘) Target size (bp) References
nuc F 5´-GCGATTGATGGTGATACGGTT -3´ 279 Kalorey et al. (2007)
R 3´-AGCCAAGCCTTGACGAACTAAAGC-5´
16S rRNA F 5´-AATTGAAGAGTTTGATCATG-3´ 704 Guan et al. (2013)

 

R 3´- CTCTACGCATTTCACCGCTAC -5´

F = Forward; R = Reverse; bp = Base pair

Table 2. Thermal profiles for the amplification of nuc gene of Staphylococcus aureus.

Steps  Temperature (°C)  Time Cycle (s) Reference
Initial denaturation  95  5 min  

 

30

 

Kalorey et al. (2007)
Denaturation  95  1 min
Annealing  55  45 sec
Extension  72  1 min
Final extension  72  10 min

Table 3. Thermal profiles for the amplification of 16S rRNA gene of E. coli.

Steps  Temperature (°C)  Time Cycle (s) Reference
Initial denaturation  95  15 min  

 

30

 

  

 

Guan et al. (2013)

 

Denaturation  94  40 sec
Annealing  56  30 sec
Extension  72  30 sec
Final extension  72  7 min

2.6 Antibiotic discs

The antibiogram of S. aureus was conducted using 12 commonly prescribed antibiotics: Azithromycin (AZM, 15 μg), Erythromycin (E, 5 μg), Cefoxitin (CX, 30 μg), Oxacillin (OX, 1 μg), Penicillin (P, 10 μg), Ciprofloxacin (CIP, 5 μg), Levofloxacin (LEV, 5 μg), Norfloxacin (CD, 2 μg), Gentamicin (GEN, 5 μg), Tetracycline (TE, 30 μg), Doxycycline (DO, 30 μg), and Vancomycin (VA, 30 μg).

Similarly, E. coli isolates were tested against ten antibiotics: Ciprofloxacin (CIP, 5 μg), Nitrofurantoin (NIT, 30 μg), Cefotaxime (CTX, 30 μg), Imipenem (IMP, 10 μg), Gentamicin (GEN, 10 μg), Ceftazidime (CAZ, 30 μg), Tetracycline (TE, 30 μg), Ampicillin (AMP, 25 μg), Chloramphenicol (C, 30 μg), and Cotrimoxazole (COT, 25 μg). Prior to testing, bacterial suspensions were adjusted to a 0.5 McFarland standard (Gayathiri et al., 2018). Antibiotic disks were obtained from HI Media, India, and susceptibility testing was performed using the disk diffusion method described by Bauer et al. (1966). The inhibition zones were interpreted according to Clinical and Laboratory Standards Institute guidelines (CLSI, 2021 a,b).

2.7 Statistical analysis

The data from this study were integrated using Excel 365 (Microsoft/Office 365, Redmond, WA). Descriptive analysis was used to determine the frequencies of the different variables. A binomial 95% confidence interval (CI) was computed to estimate the prevalence, using a prior technique described by Brown (2001) in GraphPad Prism.

3. Results

3.1 The overall prevalence of S. aureus and E. coli in raw milk sample

Ninety raw milk samples (n = 90) were collected from various local markets in Kushtia Sadar. S. aureus was detected in 35 samples, while E. coli was identified in 20 samples. The prevalence rates for S. aureus and E. coli were 38.88% and 22.22%, respectively (Table 4).

Table 4. Prevalence of S. aureus and E. coli based on culture in milk.

Name of organisms Sample tested (n) Prevalence n (%) 95% confidence interval (CI) P– value
S. aureus 90 35 (38.88) 25.2-44.8% 0.004
E. coli 20 (22.22) 11.7-28.3% 0.001

3.2 Molecular detection of S. aureus targeting nuc gene by PCR

All 35 positive isolates of S. aureus underwent PCR targeting the nuc gene to amplify a 279 bp DNA fragment. Of these, 16 out of 35 isolates (45.71%) yielded positive PCR results from milk samples (Figure 2A). All suspected E. coli isolates were further confirmed by PCR using a genus-specific 16S rRNA gene. The isolates were successfully identified as E. coli through PCR amplification (Figure 2B).

Figure 2. PCR amplification of target genes used for identification of Staphylococcus aureus and Escherichia coli. (A) Amplification of a 279 bp fragment of the nuc gene of Staphylococcus aureus. Lane M: 100 bp DNA marker; lanes 1–5: DNA samples extracted from milk; lane PC: positive control; lane NC: negative control. (B) Amplification of the 704 bp fragment of the 16S rRNA gene of Escherichia coli. Lane M: 100 bp DNA ladder; lanes 1–9: DNA samples extracted from E. coli; lane PC: positive control; lane NC: negative control.

Figure 2. PCR amplification of target genes used for identification of Staphylococcus aureus and Escherichia coli. (A) Amplification of a 279 bp fragment of the nuc gene of Staphylococcus aureus. Lane M: 100 bp DNA marker; lanes 1–5: DNA samples extracted from milk; lane PC: positive control; lane NC: negative control. (B) Amplification of the 704 bp fragment of the 16S rRNA gene of Escherichia coli. Lane M: 100 bp DNA ladder; lanes 1–9: DNA samples extracted from E. coli; lane PC: positive control; lane NC: negative control.

Table 5. Prevalence of nuc and 16S rRNA positive Staphylococcus aureus and E. coli in milk

No. of S. aureus and E. coli isolates Prevalence of nuc and 16S rRNA gene positive isolates n (%) 95% confidence interval P– value
35 16 (45.71%) 3.9 -28.1% 0.001
20 9 (45%) 1.1% – 29.6% 0.001

3.3 Antimicrobial susceptibility profile of S. aureus

All 16 nuc-positive S. aureus isolates obtained from milk were tested against 12 different antibiotics. Among these, Levofloxacin and Doxycycline demonstrated the highest susceptibility, with all 16 isolates (100%) being sensitive. Gentamycin, Azithromycin, and Ciprofloxacin exhibited susceptibility in 14 (87.50%), 13 (81.25%), and 10 (62.50%) isolates, respectively. In contrast, the lowest susceptibility was observed against Cefoxitin, Penicillin, Oxacillin, Erythromycin, Tetracycline, and Vancomycin, with susceptibility rates ranging from 0 (0.0%) to 4 (25%). Notably, the highest resistance was recorded against Penicillin, Cefoxitin, and Oxacillin, with all 16 isolates (100%) showing resistance (Figure 3).

3.4 Antimicrobial susceptibility profiles of E. coli

All 16S rRNA-positive E. coli isolates (n = 9) were tested against ten antibiotics. The highest sensitivity was observed for Gentamicin (GEN) and Nitrofurantoin (NIT), each showing 88.88% susceptibility. Ciprofloxacin (CIP), Tetracycline (TE), and Cotrimoxazole (COT) demonstrated moderate sensitivity at 55.55%. The lowest sensitivity was recorded for Ampicillin (AMP), Ceftaxime (CTX), and Ceftazidime (CAZ), with rates of 0%, 11.11%, and 22.22%, respectively. Conversely, the highest resistance was observed against Ampicillin (100%), while Gentamicin (GEN), Nitrofurantoin (NIT), and Imipenem (IMP) each showed the lowest resistance at 0% (Figure 4).

Figure 3. Antimicrobial susceptibility profiles of Staphylococcus aureus isolated from milk.

Figure 3. Antimicrobial susceptibility profiles of Staphylococcus aureus isolated from milk.

Figure 4. Antimicrobial susceptibility profiles of E. coli isolated from raw milk.

Figure 4. Antimicrobial susceptibility profiles of E. coli isolated from raw milk.

The heatmap illustrates the antimicrobial resistance profiles of S. aureus and E. coli isolates. The rows represent antibiotics, while the columns show the percentage of resistant isolates for each bacterial species. Color intensity indicates the level of resistance, with darker shades representing higher resistance. The dendrogram on the left displays hierarchical clustering of antibiotics based on similarities in resistance patterns. The figure reveals a high level of resistance in S. aureus to β-lactam antibiotics, including cefoxitin, oxacillin, and penicillin, and complete resistance in E. coli to ampicillin. In contrast, lower resistance was noted for antibiotics such as doxycycline and levofloxacin in S. aureus, as well as gentamicin and nitrofurantoin in E. coli (Figure 5). This visualization facilitates the comparison of resistance patterns between the two bacterial species.

Figure 5. Combined heatmap with hierarchical clustering dendrogram showing antimicrobial resistance patterns of Staphylococcus aureus and Escherichia coli.

Figure 5. Combined heatmap with hierarchical clustering dendrogram showing antimicrobial resistance patterns of Staphylococcus aureus and Escherichia coli.

4. Discussion

The present study investigated the occurrence and antimicrobial resistance patterns of S. aureus and E. coli isolated from raw milk samples collected from markets in Kushtia Sadar, Bangladesh. Out of 90 raw milk samples examined, S. aureus was isolated from 35 samples, yielding a prevalence of 38.88%. This indicates that raw milk sold in local markets may serve as a significant reservoir for pathogenic bacteria. Variability in prevalence rates across studies has been documented globally. For example, a recent study on raw sheep milk reported S. aureus contamination in approximately 34.9% of samples, highlighting the ongoing risks of bacterial presence in unpasteurized milk products (Rosu et al., 2025). Differences in reported prevalence may be attributed to geographic location, variations in farm hygiene and milking practices, environmental conditions, and laboratory techniques used for isolation and identification.

The prevalence reported in this study aligns with findings by Mekuria et al. (2014) and Abera et al. (2010), who documented prevalence rates of about 35.2% and 39.5% in raw milk samples from Hawassa and Debre Zeit, respectively. However, Kundu et al. (2018) reported a higher prevalence of 61.1% in raw milk from Khartoum State. Such differences among studies can be influenced by variations in sampling strategies, animal health status, and local dairy management practices.

The presence of S. aureus in raw milk can largely be explained by its widespread occurrence on the skin, nasal passages, and mucous membranes of dairy animals, as well as human handlers (Deddefo et al., 2022). The organism is also a well-known causative agent of bovine mastitis, which facilitates its transmission into milk during the milking process (Tong et al., 2025). Poor hygienic practices, contaminated milking equipment, and improper storage conditions may further contribute to the contamination of milk with this pathogen (Nyokabi et al., 2021). Thus, the detection of S. aureus in a considerable proportion of milk samples underscores the need for improved hygiene and management practices during milk production and handling.

In addition to S. aureus, E. coli was also detected in the analyzed milk samples. Among the 90 samples examined, 20 (22.22%) were identified as positive for E. coli based on their cultural and biochemical characteristics. Molecular confirmation was performed through PCR amplification targeting the 16S rRNA gene, which produced the expected amplicon size of approximately 704 bp. Of the culture-positive isolates, nine were confirmed as E. coli through PCR analysis. The presence of E. coli in raw milk generally indicates fecal contamination and reflects inadequate sanitary practices during milking or handling.

The prevalence of E. coli observed in this study is lower than the 34.4% prevalence reported by Liu et al. (2021) in raw milk samples from dairy herds in northern China. Differences in prevalence rates may be associated with variations in dairy farming systems, sanitation levels, and environmental conditions (Quintana et al., 2020). Raw milk is a nutrient-rich medium that can support the growth of various microorganisms, including potentially pathogenic bacteria. Consequently, the presence of coliform bacteria such as E. coli poses a potential public health concern, particularly when milk is consumed without proper heat treatment. Furthermore, E. coli contamination in milk may also originate from animals suffering from subclinical mastitis or from fecal contamination during the milking process (Assen and Abegaz, 2024).

Antimicrobial susceptibility testing of S. aureus isolates revealed high levels of resistance to several commonly used antibiotics. The isolates showed complete resistance to levofloxacin and doxycycline (100%), while high resistance was also observed against gentamicin (87.5%), azithromycin (81.25%), and ciprofloxacin (62.5%). In contrast, lower resistance rates were noted for erythromycin, vancomycin, and clindamycin. Similar resistance patterns have been reported in previous studies, although variations exist depending on regional antibiotic usage practices. Earlier research conducted by Jahan et al. (2015) reported that S. aureus isolates were highly resistant to penicillin, erythromycin, and amoxicillin, while showing sensitivity to neomycin, cloxacillin, ciprofloxacin, and oxacillin.

In Bangladesh, Hasan et al. (2021) reported resistance rates of 90.62% against penicillin and 71.87% against methicillin. Similarly, the present study revealed complete resistance of S. aureus isolates to both antibiotics, indicating a growing trend of antimicrobial resistance. Notably, methicillin-resistant S. aureus (MRSA) isolates were also detected in the current study, highlighting the emergence of resistant strains in dairy environments. The presence of MRSA is a significant concern for both veterinary and public health sectors, as these strains can be transmitted through contaminated milk and dairy products, potentially limiting the effectiveness of commonly used β-lactam antibiotics.

The antimicrobial susceptibility pattern of E. coli isolates in the present study showed variable resistance to several antibiotics. Complete resistance was observed to penicillin (100%), while moderate resistance was detected against gentamicin (60%) and both ampicillin and streptomycin (40%). Lower resistance was recorded for amoxicillin and sulfamethoxazole-trimethoprim (33.3%), whereas nalidixic acid (20%) and ciprofloxacin (10%) showed comparatively low resistance. A similar trend was reported by Sultana et al. (2021), where isolates showed complete resistance to ampicillin (100%). However, some differences were noted, as that study reported moderate resistance to cotrimoxazole (44.44%), lower resistance to chloramphenicol and tetracycline (22.22%), and minimal resistance to ceftazidime, cefotaxime, and ciprofloxacin (11.11%). According to Hasan et al. (2021), the isolated E. coli strains showed the greatest resistance to penicillin G (81.58%), followed by erythromycin (78.94%) and ampicillin (73.68%). The present study demonstrated higher resistance to gentamicin and streptomycin but lower resistance to ciprofloxacin. These variations may be associated with differences in antibiotic usage, geographic location, and sources of isolates.

Observations during sample collection indicated that inadequate hygienic conditions, poor milking practices, and insufficient sanitation measures may have contributed to the contamination of milk with pathogenic bacteria. Traditional dairy farming systems and communal farm management practices may further increase the risk of microbial contamination. The relatively high prevalence of S. aureus and E. coli detected in this study highlights a potential public health concern associated with the consumption of raw or improperly processed milk.

Overall, the findings highlight the importance of maintaining proper hygiene during milking, ensuring adequate sanitation of milking equipment, and implementing appropriate storage and handling procedures for raw milk. Additionally, the careful use of antimicrobial agents in livestock production is crucial to prevent the emergence and spread of antimicrobial-resistant bacteria.

5. Conclusion

Raw milk in Kushtia Sadar, Bangladesh, is often contaminated with pathogenic Staphylococcus aureus and Escherichia coli, reflecting poor hygiene during milking, handling, transportation, and marketing. The presence of multidrug-resistant isolates further heightens the public health risk associated with consuming contaminated raw milk. These findings highlight the urgent need to enhance sanitary practices throughout the milk production and supply chain. Ensuring proper hygiene during milking, maintaining the cleanliness of utensils and containers, improving transportation and storage, and preserving the cold chain are crucial steps to reduce microbial contamination. Additionally, regular microbiological monitoring of raw milk and rational antibiotic use in dairy animals are essential to limit the spread of antibiotic-resistant bacteria and to guarantee the safety and quality of raw milk for consumers.

Acknowledgements

The authors would like to express their sincere gratitude to the Department of Biotechnology & Genetic Engineering, Islamic University, Kushtia-7003, Bangladesh, for providing the essential facilities and support required to carry out this research successfully.

Funding information

No external or internal funding was received to conduct the study.

Ethical approval statement

No ethical approval is required for this study.

Data availability statement

The data generated from this study are available from the corresponding author upon reasonable request.

Informed consent statement

Informed consent was not required for the conduct of this study.

Conflict of interest

The authors declare that there are no conflicts of interest.

Author contributions

Conceptualization, experimental design, supervision, data analysis, and manuscript writing: Partha Pratim Ghosh; Conceptualization, guidance for manuscript preparation, and manuscript editing: Md. Bakhtiar Lijon; Data collection, participation in methodology, first draft preparation, and manuscript revision: Mosharraf Hossen; Methodological support, data acquisition, review, and manuscript formatting: Sheben Chandra Liton; Data collection, data validation, statistical assistance, and manuscript review: Esrat Jahan and Ummay Sumya Julia Jami; Technical support, data management, and literature review: Debasree Saha and Md. Al-Amin Sarker; Critical revision, final review, editing, and coordination of manuscript submission: Md Shiblee Sadik Sabuj, Md Jamilur Rahman, and Tanvir Ahmed. All authors have read and approved the final version of the manuscript.

References

Abera M, Demie B, Aragaw K, Regassa F and Regassa A, 2010. Isolation and identification of Staphylococcus aureus from bovine mastitic milk and their drug resistance patterns in Adama town, Ethiopia. Journal of Veterinary Medicine and Animal Health, 2(3): 29-34.

Altaie HAA, Amor MGB, Mohammed BA and Gdoura R, 2025. Detection and characterization of Escherichia coli and Escherichia coli O157: H7 in Human, Animal, and food samples from Kirkuk Province, Iraq. Microbiology Research, 16: 20. https://doi.org/10.3390/microbiolres16010020

Assen KA and Abegaz MA, 2024. Review on quality attributes of milk and commonly produced dairy products in Ethiopia. Heliyon, 10(21): e40089. https://doi.org/10.1016/j.heliyon.2024.e40089

Aydogdu T, O’Mahony JA and McCarthy NA, 2023. pH, the fundamentals for milk and dairy processing: A review. Dairy, 4(3): 395-409. https://doi.org/10.3390/dairy4030026

Bauer AW, Kirby WMM, Shrris JC and Truck M, 1966. Antibiotic susceptibility testing by a standardized single disk method. American Journal of Clinical Pathology, 45(4): 493–496. https://cir.nii.ac.jp/crid/1571417124987473664

Bose P, Sobur KA, Bakhtiar Lijon M, Zaminur Rahman M, Ahamed T, Sultana P and Ariful Islam M, 2025. Characterization of enterotoxin, antibiotic resistance genes, and antimicrobial susceptibility profiling of Staphylococcus aureus isolated from table eggs: Implications for food safety and public health. Open Veterinary Journal, 15(3): 1187. https://doi.org/10.5455/OVJ.2025.v15.i3.11

Brown AM, 2001. A step-by-step guide to non-linear regression analysis of experimental data using a Microsoft Excel spreadsheet. Computer Methods and Programs in Biomedicine, 65(3): 191-200. https://doi.org/10.1016/S0169-2607(00)00124-3

Bruckmaier R and Zinn S, 2023. From the Editors :“Mammalian milk: The elixir of life from maternal care to modern dairy production”. Animal Frontiers, 13(3): 3-4. https://doi.org/10.1093/af/vfad035

Chakraborty S, Johura FT, Sultana M, Zhang X, Sadique A, George CM and Alam M, 2024. Epidemiology of enterotoxigenic Escherichia coli among children and adults seeking care at hospitals in two geographically distinct rural areas in Bangladesh. Microorganisms, 12(2): 359. https://doi.org/10.3390/microorganisms12020359

Cheesbrough M, 1985. Medical laboratory manual for tropical countries microbiology. Cheesbrough M (Eds.). Tropical Health Technology Publishing. pp. 479.

CLSI, 2021a. Performance standards for antimicrobial susceptibility testing; document M100, 31st eds. Clinical and Laboratory Standards Institute, Wayne, PA, USA.

CLSI, 2021b. Methods for antimicrobial susceptibility testing of bacteria isolated from animals, CLSI standard VET01S, 3rd eds. Clinical and Laboratory Standards Institute, Wayne, PA, USA.

Darwesh OM, Mostafa A, El-Sayed HS and Matter IA, 2025. Recent technologies for detection of milk contaminants: characterization and mechanism of action: A review article. Discover Food, 5: 140. https://doi.org/10.1007/s44187-025-00423-5

Dash KK, Fayaz U, Dar AH, Shams R, Manzoor S, Sundarsingh A and Khan SA, 2022. A comprehensive review on heat treatments and related impact on the quality and microbial safety of milk and milk-based products. Food Chemistry Advances, 1: 100041. https://doi.org/10.1016/j.focha.2022.100041

Deddefo A, Mamo G, Leta S and Amenu K, 2022. Prevalence and molecular characteristics of Staphylococcus aureus in raw milk and milk products in Ethiopia: a systematic review and meta-analysis. International Journal of Food Contamination, 9: 8. https://doi.org/10.1186/s40550-022-00094-5

Elbarbary NK, Rhouma NR, Abdelhafeez MM, Maher A, Sherkawy HS, Nageeb HM and Shaala EKA, 2025. Escherichia coli O157: H7 prevalence in Upper Egypt: impacts on food safety and human Health, with a protection trial using natural antibacterial Piper cubeba. World Journal of Microbiology and Biotechnology, 41(11): 453. https://doi.org/10.1007/s11274-025-04620-3

Elmonir W, Abo-Remela E and Sobeih A, 2018. Public health risks of Escherichia coli and Staphylococcus aureus in raw bovine milk sold in informal markets in Egypt. The Journal of Infection in Developing Countries, 12(7): 533-541. https://doi.org/10.3855/jidc.9509

Gayathiri E, Bharathi B and Priya K, 2018. Study of the enumeration of twelve clinical important bacterial populations at 0.5 McFarland standard. International Journal of Creative Research Thoughts, 6(2): 880-893.

Gebremichael D, Tadesse A, Hailemariam F, Hailay B, Hadgu H and Kalayu G, 2024. Investigation of microbial quality of milk and milk products and isolations of some major bacteria in the central and Northwestern zones of tigray, Ethiopia. Veterinary Medicine International, 2024: 9989527. https://doi.org/10.1155/vmi/9989527

Górska-Warsewicz H, Rejman K, Laskowski W and Czeczotko M, 2019. Milk and dairy products and their nutritional contribution to the average polish diet. Nutrients, 11(8): 1771. https://doi.org/10.3390/nu11081771

Guan J, Xia LP, Wang LY, Liu JF, Gu JD and Mu BZ, 2013. Diversity and distribution of sulfate-reducing bacteria in four petroleum reservoirs detected by using 16S rRNA and dsrAB genes. International Biodeterioration & Biodegradation, 76: 58-66. https://doi.org/10.1016/j.ibiod.2012.06.021

Hasan GA, Satter MA and Ahmed KS, 2023. Molecular characterization and antimicrobial resistance of Escherichia coli in dairy products of Dhaka, Bangladesh. Bangladesh Journal of Scientific and Industrial Research, 58(2): 79-88. https://doi.org/10.3329/bjsir.v58i2.64033

Hasan KW, Tarannum N and Parveen S, 2021. Antimicrobial drug resistance of Escherichia coli and staphylococcus aureus isolated from milk and milk-based beverages of Dhaka city. Journal of Pure and Applied Microbiology, 15(3): 1472-1479. https://doi.org/10.22207/JPAM.15.3.41

Hossain MS, Jony MAH, Saha N, Islam B, Sobur KA, Mowdood S and Hossain KM, 2024. Antibiotic resistance genes detection in Escherichia coli isolated from raw meat in Rajshahi division of Bangladesh. American Journal of Microbiological Research, 12(4): 79-84. https://doi.org/10.12691/ajmr-12-4-1

Islam MA, Kabir SML and Seel SK, 2016. Molecular detection and characterization of Escherichia coli isolated from raw milk sold in different markets of Bangladesh. Bangladesh Journal of Veterinary Medicine, 14(2): 271-275. https://doi.org/10.3329/bjvm.v14i2.31408

Jahan M, Rahman M, Parvej MS, Chowdhury SMZH, Haque E, Talukder MAK and Ahmed S, 2015. Isolation and characterization of Staphylococcus aureus from raw cow milk in Bangladesh. Journal of Advanced Veterinary and Animal Research, 2: 49-55. https://doi.org/10.5455/javar.2015.b47

Kalorey DR, Shanmugam Y, Kurkure NV, Chousalkar KK, Barbuddhe SB, 2007. PCR-based detection of genes encoding virulence determinants in Staphylococcus aureus from bovine subclinical mastitis cases. Journal of Veterinary Science, 8: 151-154. https://doi.org/10.4142/jvs.2007.8.2.151

Kaur K, Singh S and Kaur R, 2024. Impact of antibiotic usage in food-producing animals on food safety and possible antibiotic alternatives. The Microbe, 4: 100097. https://doi.org/10.1016/j.microb.2024.100097

Kundu P, Dhankhar J and Sharma A, 2018. Development of non-dairy milk alternative using soymilk and almond milk. Current Research in Nutrition and Food Science Journal, 6: 203-210. http://dx.doi.org/10.12944/CRNFSJ.6.1.23

Liu H, Meng L, Dong L, Zhang Y, Wang J and Zheng N, 2021. Prevalence, antimicrobial susceptibility, and molecular characterization of Escherichia coli isolated from raw milk in dairy herds in Northern China. Frontiers in Microbiology, 12: 730656. https://doi.org/10.3389/fmicb.2021.730656

Loberiza IR, Falk FE, Green TJ and Loudon AH, 2025. Efficacy of different “boiling” methods for bacterial DNA extraction. Journal of Microbiological Methods, 237: 107245. https://doi.org/10.1016/j.mimet.2025.107245

Loor-Giler A, Robayo-Chico M, Puga-Torres B, Hernandez-Alomia F, Santander-Parra S, Piantino Ferreira A and Nuñez L, 2025. Escherichia coli O157: H7, a common contaminant of raw milk from Ecuador: isolation and molecular identification. Foods, 14(3): 410. https://doi.org/10.3390/foods14030410

Martinson JN and Walk ST, 2020. Escherichia coli residency in the gut of healthy human adults. EcoSal Plus, 9: 10-1128. https://doi.org/10.1128/ecosalplus.esp-0003-2020

Mekuria S, Fekade ARRAA and Dires B, 2014. Bacteriological study on rawmilk collected from hawassa smallholder dairy farms. Advances in Biological Research, 8(5): 194-200. https://doi.org/10.5829/idosi.abr.2014.8.5.83124

Nyokabi S, Luning PA, de Boer IJ, Korir L, Muunda E, Bebe BO and Oosting SJ, 2021. Milk quality and hygiene: Knowledge, attitudes and practices of smallholder dairy farmers in central Kenya. Food Control, 130: 108303. https://doi.org/10.1016/j.foodcont.2021.108303

Pokala A, Kraft J, Taormina VM, Michalski MC, Vors C, Torres-Gonzalez M and Bruno RS, 2024. Whole milk dairy foods and cardiometabolic health: dairy fat and beyond. Nutrition Research, 126: 99-122. https://doi.org/10.1016/j.nutres.2024.03.010

Pokharel P, Dhakal S and Dozois CM, 2023. The diversity of Escherichia coli pathotypes and vaccination strategies against this versatile bacterial pathogen. Microorganisms, 11(2): 344. https://doi.org/10.3390/microorganisms11020344

Quintana ÁR, Seseña S, Garzón A and Arias R, 2020. Factors affecting levels of airborne bacteria in dairy farms: A review. Animals, 10(3): 526. https://doi.org/10.3390/ani10030526

Rana AH, Bose P, Sobur KA, Hossen MM, Mowdood S, Hossain MK, Afroz F, Rumi NA, Hasan M, Jahan N, Titas AR and Hosen MA 2024. Molecular detection and antibiogram profiles of Escherichia coli and Vibrio cholerae isolated from raw vegetables in the northern district of Bangladesh. Journal of Bioscience and Environment Research, 1: 26-34. https://doi.org/10.69517/jber.2024.01.01.0006

Rawat S, Shrivastava N, Shrivastav A, Singh S, Singh PK, Niranjan AK and Ranjan R, 2024. Isolation and characterization of Staphylococcus aureus in bovine milk from Rewa, India. Indian Journal of Microbiology, 64(4): 1835-1845. https://doi.org/10.1007/s12088-024-01241-6

Roșu RD, Morar A, Ban-Cucerzan A, Imre M, Popa SA, Pătrînjan RT and Imre K, 2025. Raw sheep milk as a reservoir of multidrug-resistant Staphylococcus aureus: Evidence from traditional farming systems in Romania. Antibiotics, 14(8): 787. https://doi.org/10.3390/antibiotics14080787

Roy D, Ye A, Moughan PJ and Singh H, 2020. Composition, structure, and digestive dynamics of milk from different species—A review. Frontiers in Nutrition, 7: 577759. https://doi.org/10.3389/fnut.2020.577759

Salam MA, Al-Amin MY, Salam MT, Pawar JS, Akhter N, Rabaan AA and Alqumber MA, 2023. Antimicrobial resistance: a growing serious threat for global public health. In Healthcare, 11(13): 1946. https://doi.org/10.3390/healthcare11131946

Sarba EJ, Wirtu W, Gebremedhin EZ, Borena BM and Marami LM, 2023. Occurrence and antimicrobial susceptibility patterns of Escherichia coli and Escherichia coli O157 isolated from cow milk and milk products, Ethiopia. Scientific reports, 13: 16018. https://doi.org/10.1038/s41598-023-43043-8

Singh A and Ramachandran A, 2020. Assessment of hygienic milking practices and prevalence of bovine mastitis in small dairy farms of peri-urban area of Jaipur. Indian Journal of Community Medicine, 45: S21-S25. https://doi.org/10.4103/ijcm.IJCM_363_19

Subedi D, Thakur S, Gautam A, Poudel M, Jyoti S, Devkota A and Tiwari A, 2025. Milk and meat safety in Nepal: addressing challenges and exploring solutions. Science in One Health, 4: 100116. https://doi.org/10.1016/j.soh.2025.100116

Sultana T, Rabbi MF, Sarker BR, Islam MS, Begum MIA and Hossain KMM, 2021. Prevalence and antibiotic resistance patters of Escherichia coli isolated from milk and milk product. Journal of Bio-Science, 29(2): 81-91. https://doi.org/10.3329/jbs.v29i2.54957

Tommasoni C, Fiore E, Lisuzzo A and Gianesella M, 2023. Mastitis in dairy cattle: on-farm diagnostics and future perspectives. Animals, 13(15): 2538. https://doi.org/10.3390/ani13152538

Tong X, Barkema HW, Nobrega DB, Xu C, Han B, Zhang C and Gao J, 2025. Virulence of bacteria causing mastitis in dairy cows: A literature review. Microorganisms, 13: 167. https://doi.org/10.3390/microorganisms13010167

Touaitia R, Ibrahim NA, Touati A and Idres T, 2025. Staphylococcus aureus in bovine mastitis: A narrative review of prevalence, antimicrobial resistance, and advances in detection strategies. Antibiotics, 14(8): 810. https://doi.org/10.3390/antibiotics14080810

Yu W, Zhang Z, Wang Z, Lin X, Dong X and Hou Q, 2025. Comprehensive prevention and control of mastitis in dairy cows: From etiology to prevention. Veterinary Sciences, 12(9): 800. https://doi.org/10.3390/vetsci12090800

How to cite

Ghosh PP, Lijon MB, Hossen MM, Liton SC, Jahan E, Jami USJ, Saha D, Sarker MAA, Sabuj MSS, Rahman MJ and Ahmed T, 2026. Prevalence, molecular detection, and antimicrobial resistance profiles of Staphylococcus aureus and Escherichia coli in raw milk from urban milk markets of southwestern Bangladesh. Journal of Bioscience and Environment Research, 3 (1): 13-19. https://doi.org/10.69517/jber.2026.03.01.0003

CrossMark Update
Crossmark
Article Metrics
[stm-calc id="1576"]