Milk is the fresh mammary secretion obtained from dairy animals and is one of the most widely consumed and nutritionally valuable foods for humans and newborn animals (Bruckmaier and Zinn, 2023). It provides essential macronutrients and micronutrients, including proteins, fats, carbohydrates, vitamins, and minerals, which support growth, development, and overall health (Roy et al., 2020). Milk is considered a complete food and is recommended as a major component of the daily diet. Its composition includes water (87.2%), protein (3.5%), fat (3.7%), lactose (4.9%), ash (0.7%), and dry matter (12.8%) (Górska-Warsewicz et al., 2019). These constituents not only support human nutrition but also contribute to the functional and technological properties of dairy products, with proteins aiding in cheese and yogurt processing, lactose providing energy, fat contributing to flavor and texture, and minerals and vitamins supporting metabolic and bone health (Pokala et al., 2024).
Despite its high nutritional value, milk provides an ideal environment for microbial growth due to its nutrients, neutral pH, and high moisture content. It is susceptible to contamination during production, processing, storage, and distribution (Aydogdu et al., 2023; Dash et al., 2022). Pathogens such as Staphylococcus aureus, Escherichia coli, Salmonella spp., and Listeria spp. in raw or improperly processed milk can cause gastrointestinal and systemic illnesses, posing significant health risks, particularly to children, the elderly, and immunocompromised individuals (Subedi et al., 2025).
Bacterial contamination of milk is influenced by several factors during the milking and handling process. Contamination can occur from the farm environment, including soil, water, and feed, or from infected animals suffering from mastitis (Yu et al., 2025). Poor sanitation of milking equipment, unclean storage containers, and unhygienic handling practices by milkers can contribute to an increased microbial load (Singh and Ramachandran, 2020). Microorganisms may also enter the udder through the teat canal, especially in animals with subclinical or clinical mastitis, allowing pathogens to contaminate the milk directly (Tommasoni et al., 2023). Consequently, the microbial quality of milk is strongly dependent on farm management practices, personnel hygiene, and adherence to standard operating procedures during milking and storage (Gebremichael et al., 2024). In addition to these on-farm factors, post-harvest handling—such as transportation in non-refrigerated containers, exposure to ambient temperatures, and delayed processing—further promotes bacterial growth, increasing the likelihood of milk borne infections (Darwesh et al., 2025; Rana et al., 2024).
S. aureus and E. coli are major contaminants of milk with significant public health implications (Hossain et al., 2024; Elmonir et al., 2018). S. aureus, a Gram-positive bacterium that produces virulence factors and enterotoxins, causes mastitis in dairy animals, affecting milk quality and can be directly shed into milk, reflecting both animal health and milking hygiene (Touaitia et al., 2025; Rawat et al., 2024). E. coli, a Gram-negative bacterium normally found in the intestines, can contaminate milk through fecal matter, with pathogenic strains causing severe gastrointestinal illness. Both pathogens are important indicators of milk safety and hygiene, posing risks especially where raw milk is widely consumed (Loor-Giler et al., 2025; Sarba et al., 2023).
E. coli is a Gram-negative, rod-shaped bacterium belonging to the family Enterobacteriaceae. It is a normal inhabitant of the intestinal tracts of humans and warm-blooded animals and is frequently used as an indicator of fecal contamination in food and water (Elbarbary et al., 2025; Martinson and Walk, 2020). While most strains of E. coli are non-pathogenic commensals, certain pathogenic strains, including Shiga toxin-producing E. coli (STEC), enterotoxigenic, and enterohemorrhagic strains, can cause severe gastrointestinal infections, hemorrhagic colitis, and hemolytic uremic syndrome in humans (Pokharel et al., 2023). Milk contamination with E. coli primarily occurs through fecal matter during milking, handling, or transportation, often exacerbated by poor sanitation practices and inadequate hygiene of personnel and equipment (Altaie et al., 2025; Sarba et al., 2023).
Several studies conducted in Bangladesh have documented the presence of pathogenic E. coli in fecal samples from cattle, raw milk, and dairy products, indicating that milk can serve as a reservoir for these pathogens (Hasan et al., 2023; Sultana et al., 2021; Islam et al., 2016). It is estimated that approximately 20% of diarrheal cases in Bangladesh are associated with enterotoxigenic E. coli (Chakraborty et al., 2024). The widespread presence of these bacteria in milk and dairy products underscores the potential risk to consumers, especially when milk is consumed without proper heat treatment or pasteurization.
The emergence of antimicrobial-resistant bacteria is a growing global public health concern. Antibiotic use in food-producing animals has contributed to resistance in pathogens such as S. aureus and E. coli, which have been detected in milk and dairy products, posing risks to both animal health and human consumers, particularly where unpasteurized milk is commonly consumed (Kaur et al., 2024; Salam et al., 2023).
Given milk’s nutritional importance and the risks of microbial contamination and antibiotic resistance, monitoring pathogenic bacteria in raw milk is essential for food safety. In Bangladesh, the informal marketing of raw milk often lacks proper hygiene and quality control, increasing the risk of contamination with S. aureus, E. coli, and other pathogens. This study was conducted to investigate the isolation, molecular detection, and antibiotic susceptibility of S. aureus and E. coli in raw milk from Kushtia Sadar, providing baseline data to guide safer dairy production and consumption practices.
2. Materials and Methods
2.1 Ethical approval statement
No ethical approval is required for this study.
2.2 Collection of samples
A total of 90 milk samples (n = 90) were collected from local markets in Kushtia Sadar Kushtia, Bangladesh. Up to 10 ml of raw milk was aseptically collected from retail markets using a sterile falcon tube. All samples were placed in an ice box at 4 °C and transported to the Department of Biotechnology and Genetic Engineering at Islamic University-7003, Kushtia, Bangladesh for bacteriological analysis.
Figure 1. Map of the study area.
2.3 Sample process and Isolation of S. aureus and E. coli
Immediately after collection, 1 mL of raw milk was transferred into 9 mL of Tryptic Soy Broth (TSB) and Nutrient Broth (NB) and incubated at 37°C for 24 hours for enrichment. A loopful of the enriched culture was streaked onto MSA agar and incubated at 37°C for 24 hours, followed by sub-culturing on MSA to obtain pure colonies of S. aureus (Cheesbrough, 1985). Similarly, the enriched culture was streaked onto MacConkey agar and incubated at 37 °C for 24 hours, then sub-cultured onto EMB agar and incubated at 37 °C for 24 hours to obtain pure colonies of E. coli (Cheesbrough, 1985).
2.4 Identification of S. aureus and E. coli
The identification of S. aureus and E. coli was conducted by observing cultural characteristics and colony morphology on MSA, MacConkey (MAC), and EMB agar. Confirmation was achieved through Gram staining and biochemical tests, including catalase and coagulase tests for S. aureus, as well as MR–VP and indole tests for E. coli.
2.5 Molecular identification of S. aureus and E. coli by PCR
2.5.1 Extraction of DNA from S. aureus and E. coli
The genomic DNA from all suspected S. aureus and E. coli isolates was extracted using a simple boiling method (Loberiza et al., 2025; Bose et al., 2025). Briefly, a single pure colony was inoculated in nutrient broth, and all broth cultures were incubated at 37 °C for 24 hours. Then, 1 ml of the cultured broth was transferred to an Eppendorf tube and centrifuged at 10,000 rpm for 5 minutes. The supernatant was discarded, and the pellet was re-suspended in 1 ml of sterile distilled water. The Eppendorf tube was vortexed and centrifuged again. The supernatant was discarded, and the pellet was re-suspended in 100 μl of deionized distilled water. The tubes were placed in boiling water for 15 minutes and then immediately transferred to ice for 10 minutes to induce cold shock. The tube was vortexed again and centrifuged at 10,000 rpm for 10 minutes. Finally, the supernatant was collected as a source of template DNA for PCR and stored at -20 °C for future use.
A final reaction mixture of 20 μl was used for all PCR experiments, comprising 3 μl of nuclease-free water, 10 μl of master mix (Promega, Madison, WI), 1 μl each of forward and reverse primers, and 5 μl of DNA template. After amplification, the PCR results were analyzed by electrophoresis on a 1.5% agarose gel. The gel was stained with ethidium bromide and documented using a Biometra UV transilluminator (Göttingen, Germany). A 100-bp DNA ladder (Promega, Madison, WI) was used as a reference marker to confirm the anticipated size of the amplified PCR products.
A gene-specific PCR assay was performed to detect the specific genes associated with S. aureusand E. coli. The assay successfully amplified the nuc and 16S rRNA genes using the PCR technique. The oligonucleotide primers used in this study for detecting these genes in S. aureusare listed in Table 1.
Table 1. Oligonucleotide primer sequences for detection of Staphylococcus aureus and Escherichia coli.
| Target gene | Primer sequences (5‘-3‘) | Target size (bp) | References | |
| nuc | F | 5´-GCGATTGATGGTGATACGGTT -3´ | 279 | Kalorey et al. (2007) |
| R | 3´-AGCCAAGCCTTGACGAACTAAAGC-5´ | |||
| 16S rRNA | F | 5´-AATTGAAGAGTTTGATCATG-3´ | 704 | Guan et al. (2013)
|
| R | 3´- CTCTACGCATTTCACCGCTAC -5´ | |||
F = Forward; R = Reverse; bp = Base pair
Table 2. Thermal profiles for the amplification of nuc gene of Staphylococcus aureus.
| Steps | Temperature (°C) | Time | Cycle (s) | Reference |
| Initial denaturation | 95 | 5 min |
30
|
Kalorey et al. (2007) |
| Denaturation | 95 | 1 min | ||
| Annealing | 55 | 45 sec | ||
| Extension | 72 | 1 min | ||
| Final extension | 72 | 10 min |
Table 3. Thermal profiles for the amplification of 16S rRNA gene of E. coli.
| Steps | Temperature (°C) | Time | Cycle (s) | Reference |
| Initial denaturation | 95 | 15 min |
30
|
Guan et al. (2013)
|
| Denaturation | 94 | 40 sec | ||
| Annealing | 56 | 30 sec | ||
| Extension | 72 | 30 sec | ||
| Final extension | 72 | 7 min |
2.6 Antibiotic discs
The antibiogram of S. aureus was conducted using 12 commonly prescribed antibiotics: Azithromycin (AZM, 15 μg), Erythromycin (E, 5 μg), Cefoxitin (CX, 30 μg), Oxacillin (OX, 1 μg), Penicillin (P, 10 μg), Ciprofloxacin (CIP, 5 μg), Levofloxacin (LEV, 5 μg), Norfloxacin (CD, 2 μg), Gentamicin (GEN, 5 μg), Tetracycline (TE, 30 μg), Doxycycline (DO, 30 μg), and Vancomycin (VA, 30 μg).
Similarly, E. coli isolates were tested against ten antibiotics: Ciprofloxacin (CIP, 5 μg), Nitrofurantoin (NIT, 30 μg), Cefotaxime (CTX, 30 μg), Imipenem (IMP, 10 μg), Gentamicin (GEN, 10 μg), Ceftazidime (CAZ, 30 μg), Tetracycline (TE, 30 μg), Ampicillin (AMP, 25 μg), Chloramphenicol (C, 30 μg), and Cotrimoxazole (COT, 25 μg). Prior to testing, bacterial suspensions were adjusted to a 0.5 McFarland standard (Gayathiri et al., 2018). Antibiotic disks were obtained from HI Media, India, and susceptibility testing was performed using the disk diffusion method described by Bauer et al. (1966). The inhibition zones were interpreted according to Clinical and Laboratory Standards Institute guidelines (CLSI, 2021 a,b).
2.7 Statistical analysis
The data from this study were integrated using Excel 365 (Microsoft/Office 365, Redmond, WA). Descriptive analysis was used to determine the frequencies of the different variables. A binomial 95% confidence interval (CI) was computed to estimate the prevalence, using a prior technique described by Brown (2001) in GraphPad Prism.
3. Results
3.1 The overall prevalence of S. aureus and E. coli in raw milk sample
Ninety raw milk samples (n = 90) were collected from various local markets in Kushtia Sadar. S. aureus was detected in 35 samples, while E. coli was identified in 20 samples. The prevalence rates for S. aureus and E. coli were 38.88% and 22.22%, respectively (Table 4).
Table 4. Prevalence of S. aureus and E. coli based on culture in milk.
| Name of organisms | Sample tested (n) | Prevalence n (%) | 95% confidence interval (CI) | P– value |
| S. aureus | 90 | 35 (38.88) | 25.2-44.8% | 0.004 |
| E. coli | 20 (22.22) | 11.7-28.3% | 0.001 |
3.2 Molecular detection of S. aureus targeting nuc gene by PCR
All 35 positive isolates of S. aureus underwent PCR targeting the nuc gene to amplify a 279 bp DNA fragment. Of these, 16 out of 35 isolates (45.71%) yielded positive PCR results from milk samples (Figure 2A). All suspected E. coli isolates were further confirmed by PCR using a genus-specific 16S rRNA gene. The isolates were successfully identified as E. coli through PCR amplification (Figure 2B).
Figure 2. PCR amplification of target genes used for identification of Staphylococcus aureus and Escherichia coli. (A) Amplification of a 279 bp fragment of the nuc gene of Staphylococcus aureus. Lane M: 100 bp DNA marker; lanes 1–5: DNA samples extracted from milk; lane PC: positive control; lane NC: negative control. (B) Amplification of the 704 bp fragment of the 16S rRNA gene of Escherichia coli. Lane M: 100 bp DNA ladder; lanes 1–9: DNA samples extracted from E. coli; lane PC: positive control; lane NC: negative control.
Table 5. Prevalence of nuc and 16S rRNA positive Staphylococcus aureus and E. coli in milk
| No. of S. aureus and E. coli isolates | Prevalence of nuc and 16S rRNA gene positive isolates n (%) | 95% confidence interval | P– value |
| 35 | 16 (45.71%) | 3.9 -28.1% | 0.001 |
| 20 | 9 (45%) | 1.1% – 29.6% | 0.001 |
3.3 Antimicrobial susceptibility profile of S. aureus
All 16 nuc-positive S. aureus isolates obtained from milk were tested against 12 different antibiotics. Among these, Levofloxacin and Doxycycline demonstrated the highest susceptibility, with all 16 isolates (100%) being sensitive. Gentamycin, Azithromycin, and Ciprofloxacin exhibited susceptibility in 14 (87.50%), 13 (81.25%), and 10 (62.50%) isolates, respectively. In contrast, the lowest susceptibility was observed against Cefoxitin, Penicillin, Oxacillin, Erythromycin, Tetracycline, and Vancomycin, with susceptibility rates ranging from 0 (0.0%) to 4 (25%). Notably, the highest resistance was recorded against Penicillin, Cefoxitin, and Oxacillin, with all 16 isolates (100%) showing resistance (Figure 3).
3.4 Antimicrobial susceptibility profiles of E. coli
All 16S rRNA-positive E. coli isolates (n = 9) were tested against ten antibiotics. The highest sensitivity was observed for Gentamicin (GEN) and Nitrofurantoin (NIT), each showing 88.88% susceptibility. Ciprofloxacin (CIP), Tetracycline (TE), and Cotrimoxazole (COT) demonstrated moderate sensitivity at 55.55%. The lowest sensitivity was recorded for Ampicillin (AMP), Ceftaxime (CTX), and Ceftazidime (CAZ), with rates of 0%, 11.11%, and 22.22%, respectively. Conversely, the highest resistance was observed against Ampicillin (100%), while Gentamicin (GEN), Nitrofurantoin (NIT), and Imipenem (IMP) each showed the lowest resistance at 0% (Figure 4).
Figure 3. Antimicrobial susceptibility profiles of Staphylococcus aureus isolated from milk.
Figure 4. Antimicrobial susceptibility profiles of E. coli isolated from raw milk.
The heatmap illustrates the antimicrobial resistance profiles of S. aureus and E. coli isolates. The rows represent antibiotics, while the columns show the percentage of resistant isolates for each bacterial species. Color intensity indicates the level of resistance, with darker shades representing higher resistance. The dendrogram on the left displays hierarchical clustering of antibiotics based on similarities in resistance patterns. The figure reveals a high level of resistance in S. aureus to β-lactam antibiotics, including cefoxitin, oxacillin, and penicillin, and complete resistance in E. coli to ampicillin. In contrast, lower resistance was noted for antibiotics such as doxycycline and levofloxacin in S. aureus, as well as gentamicin and nitrofurantoin in E. coli (Figure 5). This visualization facilitates the comparison of resistance patterns between the two bacterial species.
Figure 5. Combined heatmap with hierarchical clustering dendrogram showing antimicrobial resistance patterns of Staphylococcus aureus and Escherichia coli.
4. Discussion
The present study investigated the occurrence and antimicrobial resistance patterns of S. aureus and E. coli isolated from raw milk samples collected from markets in Kushtia Sadar, Bangladesh. Out of 90 raw milk samples examined, S. aureus was isolated from 35 samples, yielding a prevalence of 38.88%. This indicates that raw milk sold in local markets may serve as a significant reservoir for pathogenic bacteria. Variability in prevalence rates across studies has been documented globally. For example, a recent study on raw sheep milk reported S. aureus contamination in approximately 34.9% of samples, highlighting the ongoing risks of bacterial presence in unpasteurized milk products (Rosu et al., 2025). Differences in reported prevalence may be attributed to geographic location, variations in farm hygiene and milking practices, environmental conditions, and laboratory techniques used for isolation and identification.
The prevalence reported in this study aligns with findings by Mekuria et al. (2014) and Abera et al. (2010), who documented prevalence rates of about 35.2% and 39.5% in raw milk samples from Hawassa and Debre Zeit, respectively. However, Kundu et al. (2018) reported a higher prevalence of 61.1% in raw milk from Khartoum State. Such differences among studies can be influenced by variations in sampling strategies, animal health status, and local dairy management practices.
The presence of S. aureus in raw milk can largely be explained by its widespread occurrence on the skin, nasal passages, and mucous membranes of dairy animals, as well as human handlers (Deddefo et al., 2022). The organism is also a well-known causative agent of bovine mastitis, which facilitates its transmission into milk during the milking process (Tong et al., 2025). Poor hygienic practices, contaminated milking equipment, and improper storage conditions may further contribute to the contamination of milk with this pathogen (Nyokabi et al., 2021). Thus, the detection of S. aureus in a considerable proportion of milk samples underscores the need for improved hygiene and management practices during milk production and handling.
In addition to S. aureus, E. coli was also detected in the analyzed milk samples. Among the 90 samples examined, 20 (22.22%) were identified as positive for E. coli based on their cultural and biochemical characteristics. Molecular confirmation was performed through PCR amplification targeting the 16S rRNA gene, which produced the expected amplicon size of approximately 704 bp. Of the culture-positive isolates, nine were confirmed as E. coli through PCR analysis. The presence of E. coli in raw milk generally indicates fecal contamination and reflects inadequate sanitary practices during milking or handling.
The prevalence of E. coli observed in this study is lower than the 34.4% prevalence reported by Liu et al. (2021) in raw milk samples from dairy herds in northern China. Differences in prevalence rates may be associated with variations in dairy farming systems, sanitation levels, and environmental conditions (Quintana et al., 2020). Raw milk is a nutrient-rich medium that can support the growth of various microorganisms, including potentially pathogenic bacteria. Consequently, the presence of coliform bacteria such as E. coli poses a potential public health concern, particularly when milk is consumed without proper heat treatment. Furthermore, E. coli contamination in milk may also originate from animals suffering from subclinical mastitis or from fecal contamination during the milking process (Assen and Abegaz, 2024).
Antimicrobial susceptibility testing of S. aureus isolates revealed high levels of resistance to several commonly used antibiotics. The isolates showed complete resistance to levofloxacin and doxycycline (100%), while high resistance was also observed against gentamicin (87.5%), azithromycin (81.25%), and ciprofloxacin (62.5%). In contrast, lower resistance rates were noted for erythromycin, vancomycin, and clindamycin. Similar resistance patterns have been reported in previous studies, although variations exist depending on regional antibiotic usage practices. Earlier research conducted by Jahan et al. (2015) reported that S. aureus isolates were highly resistant to penicillin, erythromycin, and amoxicillin, while showing sensitivity to neomycin, cloxacillin, ciprofloxacin, and oxacillin.
In Bangladesh, Hasan et al. (2021) reported resistance rates of 90.62% against penicillin and 71.87% against methicillin. Similarly, the present study revealed complete resistance of S. aureus isolates to both antibiotics, indicating a growing trend of antimicrobial resistance. Notably, methicillin-resistant S. aureus (MRSA) isolates were also detected in the current study, highlighting the emergence of resistant strains in dairy environments. The presence of MRSA is a significant concern for both veterinary and public health sectors, as these strains can be transmitted through contaminated milk and dairy products, potentially limiting the effectiveness of commonly used β-lactam antibiotics.
The antimicrobial susceptibility pattern of E. coli isolates in the present study showed variable resistance to several antibiotics. Complete resistance was observed to penicillin (100%), while moderate resistance was detected against gentamicin (60%) and both ampicillin and streptomycin (40%). Lower resistance was recorded for amoxicillin and sulfamethoxazole-trimethoprim (33.3%), whereas nalidixic acid (20%) and ciprofloxacin (10%) showed comparatively low resistance. A similar trend was reported by Sultana et al. (2021), where isolates showed complete resistance to ampicillin (100%). However, some differences were noted, as that study reported moderate resistance to cotrimoxazole (44.44%), lower resistance to chloramphenicol and tetracycline (22.22%), and minimal resistance to ceftazidime, cefotaxime, and ciprofloxacin (11.11%). According to Hasan et al. (2021), the isolated E. coli strains showed the greatest resistance to penicillin G (81.58%), followed by erythromycin (78.94%) and ampicillin (73.68%). The present study demonstrated higher resistance to gentamicin and streptomycin but lower resistance to ciprofloxacin. These variations may be associated with differences in antibiotic usage, geographic location, and sources of isolates.
Observations during sample collection indicated that inadequate hygienic conditions, poor milking practices, and insufficient sanitation measures may have contributed to the contamination of milk with pathogenic bacteria. Traditional dairy farming systems and communal farm management practices may further increase the risk of microbial contamination. The relatively high prevalence of S. aureus and E. coli detected in this study highlights a potential public health concern associated with the consumption of raw or improperly processed milk.
Overall, the findings highlight the importance of maintaining proper hygiene during milking, ensuring adequate sanitation of milking equipment, and implementing appropriate storage and handling procedures for raw milk. Additionally, the careful use of antimicrobial agents in livestock production is crucial to prevent the emergence and spread of antimicrobial-resistant bacteria.
5. Conclusion
Raw milk in Kushtia Sadar, Bangladesh, is often contaminated with pathogenic Staphylococcus aureus and Escherichia coli, reflecting poor hygiene during milking, handling, transportation, and marketing. The presence of multidrug-resistant isolates further heightens the public health risk associated with consuming contaminated raw milk. These findings highlight the urgent need to enhance sanitary practices throughout the milk production and supply chain. Ensuring proper hygiene during milking, maintaining the cleanliness of utensils and containers, improving transportation and storage, and preserving the cold chain are crucial steps to reduce microbial contamination. Additionally, regular microbiological monitoring of raw milk and rational antibiotic use in dairy animals are essential to limit the spread of antibiotic-resistant bacteria and to guarantee the safety and quality of raw milk for consumers.
