Outline
Figures

Volume: 03

Issue: 01

Page: 9-15

ISSN: 3079-5826

Characterization of indigenous planktonic and benthic microalgae from Malaysian shrimp farm

Mohd Ihsanuddin Ahmad1,2,ɸORCIDEllieelisa Martine1,ɸORCIDHazwani Hanim Hasnan2ORCIDHui Teng Tan1ORCIDYam Sim Khaw2ORCIDIkhsan Natrah1*ORCID
Show More ▼

1 Department of Aquaculture, Faculty of Agriculture, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia

2 Aquatic Animal Health and Therapeutics Laboratory, Institute of Bioscience, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia

ɸ Authors contributed equally and both can be considered as first authors

*Corresponding author
Email address: natrah@upm.edu.my

doi: https://doi.org/10.69517/jars.2026.03.01.0003

Share:

Received:
7 August, 2025

Revised:
20 October, 2025

Accepted:
24 November, 2025

Published:
26 March, 2026

  • Five microalgae strains isolated from Malaysian shrimp farm ponds.
  • Picochlorum sp. and Amphora sp. showed highest growth performance.
  • Nannochloris sp. and Picochlorum oklahomense dominated pond environments.
  • Planktonic strains grew faster than benthic strains within 14 days.
  • Biomass yield ranged from 1.01–1.90 g L⁻¹ under tested culture conditions.

Abstract

Microalgae play a critical role in aquaculture as live food and water quality enhancers; however, the potential of indigenous strains from shrimp farms remains underexplored. This study isolated, identified, and evaluated the growth performance of microalgae from a commercial shrimp farm in Selangor, Malaysia. Microalgal samples were collected from water samples of three shrimp ponds and two wastewater outlets, and were identified based on morphological observation and molecular analysis of 16S rRNA, 18S rRNA, and ITS regions. The results indicate that the isolated samples consist of three main groups with five different strains, including the planktonic cyanobacterium (Synechococcus elongatus), diatom (Amphora sp.), and green microalgae (Picochlorum sp., Nannochloris sp., and Picochlorum oklahomense). Over a 14-day cultivation period, biomass ranged from 1.01 to 1.90 g L⁻¹ by Day 10, with no significant differences (p > 0.05) among the strains. The planktonic species (Picochlorum spp., Nannochloris sp., and S. elongatus) maintained a higher growth rate compared to the benthic Amphora sp., where sedimentation reduced light exposure and underestimated its growth potential. Picochlorum sp. exhibited rapid initial growth, while S. elongatus achieved the highest final biomass after a slower acclimation phase. The widespread occurrence of green microalgae across multiple sites suggests broad environmental tolerance, while the site-restricted cyanobacteria and diatom likely indicate niche specialization. Planktonic strains demonstrated greater suitability for suspended cultures and live food production, whereas benthic diatoms may be more applicable in biofilm-based nutrient recovery systems. Overall, these findings highlight shrimp farm environments as reservoirs of diverse and ecologically distinct microalgae with promising potential for sustainable aquaculture applications.

Graphical Abstract

Keywords

Indigenous microalgae, Shrimp farm, Biomass productivity, Aquaculture sustainability

1. Introduction

Microalgae are photosynthetic microorganisms that produce high-value biomass due to their simple cellular structure, efficient nutrient uptake, and adaptability to diverse aquatic environments (Sarıtaş et al., 2025; Natrah et al., 2011). They synthesize essential biomolecules, including lipids, proteins, carbohydrates, pigments, and vitamins, making microalgae a valuable resource for industries such as cosmetics, pharmaceuticals, bioenergy, and aquaculture (Ahmad et al., 2024; Fernandes et al., 2021; Becker, 2007). In shrimp aquaculture, microalgae are widely used as live food for mollusks, crustaceans, and fish larvae because of their high nutritional value and digestibility (Michels, 2015). Species such as Tetraselmis suecica, Isochrysis galbana, and Skeletonema costatum are commonly utilized in larviculture, serving not only as a dietary source but also as biological agents that enhance water quality (Ma and Hu, 2024). Microalgae improve culture conditions by increasing dissolved oxygen through photosynthesis, assimilating nitrogenous waste, and suppressing pathogens via competition and quorum sensing inhibition (QSI) (Baharuddin et al., 2024; Han et al., 2019). Certain species can disrupt bacterial quorum sensing systems, providing a natural biocontrol mechanism that reduces virulence and biofilm formation, thus offering an alternative to antibiotic use in aquaculture (Jiang et al., 2019).

Shrimps, particularly penaeid species like Penaeus monodon, are economically significant in aquaculture and have a complex developmental lifecycle that includes nauplius, zoea, mysis, and postlarval stages (Vance and Rothlisberg, 2020). During the zoea and mysis phases, shrimp rely heavily on microalgae and phytoplankton for nutrition (Brown et al., 1997). Their anatomical adaptations, including a cephalothorax and abdomen with specialized feeding and locomotion appendages, enable them to thrive in various aquaculture environments (Ruppert et al., 2004). However, intensive culture practices in tropical conditions (25 °C to 32 °C), common in Malaysian shrimp farms, have increased the risk of disease outbreaks (Nazarudin et al., 2025; Brumfield et al., 2023; Pragthong et al., 2020).

Despite the widespread use of imported strains, research on locally sourced microalgae remains limited, even though such strains may be better adapted to native environments. As autotrophic organisms, microalgae thrive in diverse marine and freshwater habitats, providing both nutritional and bioremediation benefits to aquaculture systems. To address this knowledge gap, this study aimed to isolate, identify, and characterize indigenous microalgae from a Malaysian shrimp farm using both morphological and molecular techniques. Among the isolates, Picochlorum sp. and Synechococcus elongatus were selected for further evaluation based on their distinct physiological traits and ecological relevance. Picochlorum sp. is a robust green microalga known for its high salinity tolerance, rapid growth, and production of bioactive compounds, making it well-suited to the variable conditions of shrimp ponds (Krishnan et al., 2025; Foflonker et al., 2018). Meanwhile, S. elongatus, a fast-growing cyanobacterium, has been extensively studied for its high photosynthetic efficiency and simple genetic architecture, making it an excellent model for biotechnological applications and nutrient recycling in aquaculture (Meng et al., 2025; Mills et al., 2022). Together, these traits align with the goals of sustainable aquaculture, particularly in enhancing shrimp health, improving water quality, and reducing reliance on synthetic additives.

The study explores the diversity and functional potential of indigenous microalgae from Malaysian shrimp ponds, focusing on their adaptability and suitability for tropical aquaculture systems. It is anticipated that indigenous species will exhibit distinct morphological and genetic characteristics compared to widely used commercial strains. Selected isolates, such as Picochlorum sp. and S. elongatus, are expected to demonstrate high growth performance, nutrient uptake efficiency, and quorum-sensing inhibition capabilities. By addressing these hypotheses, the research aims to provide a scientific basis for utilizing native microalgae as functional components in sustainable shrimp farming. The outcomes of this study are expected to have significant implications for the aquaculture industry, as insights gained from identifying and evaluating locally adapted microalgae will support the development of region-specific biological resources for shrimp hatcheries and grow-out systems. These findings will contribute to reducing dependence on imported strains, improving pond ecology, and promoting environmentally responsible aquaculture practices aligned with antimicrobial resistance (AMR) mitigation goals in tropical production systems.

2. Materials and Methods

2.1 Ethics declarations

Not applicable.

2.2 Sample collection and culture media preparation

This study was conducted from May, 2022, to December 1, 2022, at Zaiyadal Aquaculture Sdn. Bhd., located in the northwestern region of Selangor, Malaysia (3.680000°N, 100.970000°E) (Figure 1). Water samples were collected from five shrimp culture sites within the facility, comprising both wastewater (WW) and shrimp pond water (PW) sources. The specific sampling points were: WW 1 (3.678077°N, 100.965825°E), WW 1.2 (3.677671°N, 100.966266°E), PW 1 (3.677629°N, 100.965872°E), PW 2 (3.677509°N, 100.965326°E), and PW 3 (3.677303°N, 100.965172°E) (Figure 2). Samples were obtained using a plankton net (10-30 cm) with a 60 µm mesh size. The collected water samples were transferred into clean bottles with loose-fitting caps to allow for air exchange and were transported at room temperature for immediate laboratory processing. For cultivation, Conway medium, enriched with and without silicate, was prepared according to Walne (1970) using filtered seawater supplemented with nutrients, trace metals, and vitamins to support diverse microalgae types, including diatoms.

2.3 Microalgae isolation and purification

Microalgae were isolated using the single-cell micropipette technique under aseptic conditions, following previously described procedures (Andersen, 2005; Guillard, 2005; Stein, 1980). Individual microalgal cells were separated from pond water samples with a modified Pasteur pipette under a light microscope and transferred into sterilized Conway medium. This isolation process was repeated several times to ensure single-cell purity before transferring each cell into 10 mL culture tubes. The cultures were incubated under a 12:12 h light–dark cycle at 25 °C, illuminated by fluorescent light at 60–75 µmol photons m⁻² s⁻¹.

Figure 1. Zaiyadal Aquaculture Sdn. Bhd located in West Malaysia.

Figure 1. Zaiyadal Aquaculture Sdn. Bhd located in West Malaysia.

Figure 2. Sampling locations at Zaiyadal Aquaculture Sdn. Bhd., Selangor, Malaysia. Water samples were collected from three water pond sites (PW1, PW2, PW3) and two wastewater discharge channels (WW1, WW1.2). WW = Wastewater; PW = Pond water.

Figure 2. Sampling locations at Zaiyadal Aquaculture Sdn. Bhd., Selangor, Malaysia. Water samples were collected from three water pond sites (PW1, PW2, PW3) and two wastewater discharge channels (WW1, WW1.2). WW = Wastewater; PW = Pond water.

Purification of the isolates was achieved through repeated streaking on Conway agar plates (1.5% agar) and subsequent incubation under similar conditions, as adapted from Andersen (2005) and Torzillo and Vonshak (2013). Colonies that appeared after approximately three weeks were sub-cultured multiple times to eliminate bacterial contaminants. Antibiotics (streptomycin and penicillin) were added during the early purification stages to suppress bacterial growth (Day et al., 2012; Kooistra et al., 2008). Once axenic status was confirmed microscopically, the isolates were transferred into liquid Conway medium and gradually upscaled for further analyses.

All purified cultures were maintained at 30 ppt salinity, 25 ± 2 °C, and a light intensity of 40 µmol photons m⁻² s⁻¹. Pure colonies were initially inoculated into 10 mL of Conway medium and progressively scaled up in larger Erlenmeyer flasks to obtain sufficient biomass for physiological and molecular characterization.

2.4 Microalgae identification

The identification of isolated microalgae strains was conducted using a polyphasic approach that combined morphological and molecular techniques for accurate taxonomic resolution (John et al., 2002; Komárek and Fott, 1983). Morphological characterization was first performed with a compound light microscope (Carl Zeiss Axioscope A1, Germany) equipped with a high-resolution CCD camera, under varying magnifications of 100×, 200×, 400×, and 1000×. Microalgae suspensions (1 µL) were mounted on glass slides and examined for diagnostic features, including cell shape, pigmentation, symmetry, and arrangement. Oil immersion was employed at 1000× magnification to reduce light refraction, and lenses were cleaned with lens paper to avoid optical damage.

For molecular identification, genomic DNA was extracted from axenic cultures using the PrimeWay Plant DNA Extraction Kit (Apical Scientific, Malaysia), following the manufacturer’s protocol. The quality and size of the DNA were assessed via gel electrophoresis using a Bio-Rad PowerPac™ Basic power supply and a UVP GelDoc-It®2 310 Imaging System. A 1% agarose gel stained with FloroSafe DNA stain (EURx, Poland) was prepared with 1× TAE buffer, and electrophoresis was conducted at 70 V for 60 minutes. PCR amplification was then performed in a T100™ Thermal Cycler (Bio-Rad, USA) using three primer sets targeting the 16S rRNA, 18S rRNA, and ITS regions. Each reaction mixture contained the DNA template, forward and reverse primers, 2× ViRed Taq Master Mix (Vivantis, Malaysia), and DEPC-treated water. Thermocycling conditions were optimized based on the primer annealing temperatures, and the final PCR products were visualized by gel electrophoresis. Successfully amplified products were submitted to Apical Scientific Sdn. Bhd. for Sanger sequencing using an ABI 3770XL DNA sequencer. The resulting sequences were analyzed using NCBI’s Basic Local Alignment Search Tool (BLAST) for species identification and submitted to the GenBank database for accession number assignment (Table 1).

Table 1. Primer sets and sequences used for molecular identification of microalgae isolates.

Primer sets Primers Sequences (5’-3’) A (⁰C) Size (bp) Target gene
1 CF GACGGGTGAGTAACGCGTGAG 54 800 16S rRNA
CR CGAATTCACYGCAGTATGCTG
2 ITS F TCCGTAGGTGAACCTGCGG 54.2 600 ITS
ITS R TCCTCCGCTTATTGATATGC
3 ss5 GGTGATCCTGCCAGTAGTCATATGCTTG 56.8 1800 18S rRNA
ss3 GATCCTTCCGCAGGTTCACCTACGGAAACC

Note: bp = base pair, CF = Cyanobacterial Forward primer; CR = Cyanobacterial Reverse primer; ITS F = Internal Transcribed Spacer Forward primer; ITS R = Internal Transcribed Spacer Reverse primer; ss5 = Small Subunit Forward primer (18S rRNA); ss3 = Small Subunit Reverse primer (18S rRNA). Forward primers (F) anneal to the 5′ end of the target region, while reverse primers (R) anneal to the complementary 3′ end.

2.5 Microalgae growth analysis

Microalgae growth was monitored over a 14-day culture period using two standard analytical methods: biomass quantification and optical density (OD) measurement. Biomass was quantified gravimetrically by filtering 5 mL of culture through pre-treated Whatman GF/C glass microfiber filters (47 mm, pore size ~1.2 µm). Prior to filtration, the filters were dried at 60 °C for 24 hours in a laboratory oven (Memmert UN55, Germany) and then cooled in a vacuum desiccator (Kartell, Italy) before recording their initial weights using a precision analytical balance (Sartorius Cubis II, Germany). After filtering the culture, the filters were rinsed with 5 mL of 0.5 M ammonium formate (NH₄HCO₂), prepared by dissolving 31.53 g of ammonium formate (molecular weight 63.06 g/mol) in 1 L of distilled water. This washing step removed residual salts that could interfere with dry weight measurements (Safi et al., 2014). After rinsing, the filters were re-dried under the same conditions, cooled, and reweighed to calculate net biomass. Each sample was measured in triplicate, and the biomass concentration (mg/mL) was calculated using the following formula,

For OD analysis, 2 mL of each triplicate sample was pipetted into a quartz cuvette and measured at 680 nm using a UV-1900 UV-VIS spectrophotometer (Shimadzu, Japan). This wavelength is standard for estimating microalgae concentration, as it correlates with chlorophyll a absorption (Saccardo et al., 2024). Mean absorbance values served as an indirect indicator of microalgal growth and cell density. The combined use of biomass and absorbance measurements provided a robust and complementary assessment of microalgae growth performance under the experimental conditions.

2.6 Statistical analysis

All experimental data are presented as mean values ± standard deviation (SD) based on triplicate measurements. Normality tests were conducted to verify compliance with the assumptions of parametric tests. A one-way analysis of variance (ANOVA) was performed to assess significant differences among treatments for microalgae growth parameters, including OD and biomass. When significant differences were detected, Tukey’s post-hoc test was employed for pairwise comparisons. Statistical analyses were conducted using Minitab version 17.1 (Minitab Inc., USA), with statistical significance set at P < 0.05.

3. Results and Discussion

3.1 Isolation and identification of indigenous microalgae strains

A total of five distinct microalgae strains were successfully isolated and identified from multiple sites at Zaiyadal Aquaculture Sdn. Bhd. in Selangor, Malaysia. Sampling points included both wastewater (WW) and pond water (PW) systems, with precise GPS coordinates recorded for each site. Green microalgae were the most frequently encountered group, isolated from two different wastewater sites (WW1 and WW2) and one pond (PW2) (Table 2). One blue-green microalga was isolated from one pond (PW1), and one diatom was identified from another pond (PW3). These findings suggest that green microalgae exhibit greater ecological adaptability to both nutrient-enriched wastewater and pond environments, while the distribution of cyanobacteria and diatoms appears to be site-specific, potentially influenced by environmental factors such as light penetration, nutrient gradients, or sedimentation. However, these interpretations remain speculative and warrant further investigation to confirm the ecological drivers underlying the observed distribution.

Table 2. Distribution of isolated microalgae types across sampling points.

Sampling point Green microalgae Cyanobacteria Diatom
WW 1 √
WW 1.2 √
PW 1 √
PW 2 √
PW 3 √

Note: Tick marks (√) indicate the presence of microalgae types identified at each sampling site. WW = wastewater; PW = pond water.

 

Morphological and molecular identification of the isolates revealed diverse taxa with distinct ecological roles (Table 3). Among the isolated samples was the cyanobacterium S. elongates QS-A0001, a planktonic organism with a rod to elliptical shape and blue-green pigmentation. Next is a benthic diatom classified as Amphora sp. (QS-A0002), recognized by its semi-elliptical shape and brown coloration. Three other green microalgae were identified: Picochlorum sp. (QS-A0003), P. oklahomense (QS-A0005), and Nannochloris sp. (QS-A0004), all of which are round, planktonic species with biotechnological potential due to their rapid growth and broad environmental tolerance. The diversity of these isolates highlights their potential for use in integrated systems for water quality improvement and shrimp nutrition (Nazarudin et al., 2025; Zhou et al., 2023).

The successful isolation of five morphologically and genetically distinct microalgal strains from both wastewater (WW) and pond water (PW) systems at aquaculture sites underscores the microalgal diversity present in shrimp farming environments. The predominance of green microalgae at three of the five sampling points suggests that Chlorophyta possess greater ecological plasticity, enabling them to thrive under both nutrient-enriched wastewater conditions and more stable pond environments. This observation aligns with recent findings on the resilience of green microalgae to fluctuations in nutrients, salinity, and light (Dao et al., 2024; Couto et al., 2022; Hotos et al., 2021). In contrast, the limited occurrence of cyanobacteria and diatoms suggests narrower ecological requirements, potentially linked to localized nutrient profiles, sediment composition, or hydrodynamic regimes (Bellinger and Sigee, 2010). Taxonomic confirmation across the major groups, including cyanobacteria, diatoms, and green microalgae, reflects their ecologically significant and complementary roles in aquaculture systems. For instance, cyanobacteria such as S. elongatus contribute markedly to primary productivity and supply organic matter to the food web (Saleem et al., 2025; Kupriyanova et al., 2024).  Benthic diatoms, such as Amphora sp., facilitate biofilm formation and benthic–pelagic nutrient coupling, thereby enhancing nutrient recycling (Agostino et al., 2024). Planktonic green microalgae, including Picochlorum spp. and Nannochloris sp., are noted for their high growth rates, environmental tolerance, and established use as live food in aquaculture (Barten et al., 2022; Krishnan et al., 2021). Ecologically, the observed species distribution reflects the selective pressures characteristic of intensive aquaculture, such as nutrient enrichment from shrimp effluent, reduced light penetration due to suspended solids, and hydrological variation between wastewater outlets and pond systems. These conditions likely promote niche partitioning that favors distinct algal groups (Fuß et al., 2025; Borics et al., 2021). From an applied perspective, the co-occurrence of robust planktonic chlorophytes and benthic diatoms presents opportunities for Integrated Multi-Trophic Aquaculture (IMTA) strategies. Green microalgae could play dual roles in enhancing water quality and serving as a direct live food supplement, while benthic species could aid in sediment stabilization and nutrient cycling. Overall, the findings demonstrate that shrimp ponds are reservoirs of ecologically diverse and biotechnologically valuable microalgae, with potential applications in water remediation, aquaculture nutrition, and bioactive compound discovery.

Table 3. Molecular identification and characterization of isolated microalgae from shrimp aquaculture systems.

Strains Microalgae Cell shapes Pigmentation Characteristics GenBank accession number
QS-A0001 Synechococcus elongatus Rod/ Elliptical Blue- Green Planktonic PP069757
QS-A0002 Amphora sp. Semi-elliptical Brown Benthic PP098293
QS-A0003 Picochlorum sp. Round Green Planktonic PP099120
QS-A0004 Nannochloris sp. Round Green Planktonic PP091225
QS-A0005 Picochlorum oklahomense Round Green Planktonic PP101324

3.2 Biomass growth analysis 

Biomass analysis conducted on days 5 and 10 demonstrated measurable growth across all five isolated microalgae strains during the 14-day cultivation period, although no statistically significant differences were observed among treatments (P > 0.05) (Table 4). On day 5, Picochlorum sp. recorded the highest biomass at 1.66 ± 0.08 g/L, followed by Nannochlorissp. (1.62 ± 0.30 g/L) and S. elongatus (1.55 ± 0.16 g/L), while Amphora sp. yielded the lowest biomass at 1.01 ± 0.24 g/L. By day 10, all strains exhibited increased dry weight, with S. elongatus achieving the highest biomass (1.90 ± 0.41 g/L), followed by Nannochloris sp. (1.71 ± 0.16 g/L), P. oklahomense (1.62 ± 0.14 g/L), and Amphora sp. (1.56 ± 0.20 g/L). Interestingly, Picochlorum sp., which initially had the highest biomass, showed a slight decline to 1.59 ± 0.13 g/L on day 10. Despite these variations, the lack of statistical significance (P > 0.05) indicates that all isolates exhibited comparable biomass productivity under the same culture conditions.

Table 4. Biomass concentration (g/L) of isolated microalgae strains on day 5 and day 10 of cultivation.

Microalgae Strains Day 5 (g/L) Day 10 (g/L)
Synechococcus elongatus QS-A0001 1.55 ± 0.16a 1.90 ± 0.41a
Amphora sp. QS-A0002 1.01 ± 0.24a 1.56 ± 0.20a
Picochlorum sp. QS-A0003 1.66 ± 0.08a 1.59 ± 0.13a
Nannochloris sp. QS-A0004 1.62 ± 0.30a 1.71 ± 0.16a
Picochlorum oklahomense QS-A0005 1.37 ± 0.21a 1.62 ± 0.14a

Values are presented as mean ± standard deviation (n = 3). Different superscript letters within the same column indicate significant differences (P < 0.05) based on one-way ANOVA followed by Tukey’s post-hoc test.

 

It is important to note that biomass values were derived from xenic cultures, where co-occurring bacterial communities may have influenced total dry weight (Iyer et al., 2025). Although this complicates direct quantification, bacteria can enhance algal productivity through nutrient recycling, vitamin production, and ecological interactions. This underscores the significance of considering microbial community composition when assessing microalgal growth performance for aquaculture applications (Chin et al., 2025). These findings indicate that species-specific growth dynamics, culture morphology (planktonic versus benthic), and microbial associations must be carefully evaluated when selecting candidate strains for biomass production in integrated aquaculture systems.

3.3 Optical density growth analysis  

Growth trends over the 14-day period, Figure 3 showed consistently higher OD values in P. oklahomense and S. elongatus, while Amphora sp. remained consistently low. Similar patterns have been observed in benthic diatoms, which often require culture modifications, such as continuous agitation or inclined surfaces, to enhance resuspension and light penetration (Shen et al., 2024; Orefice et al., 2019). In contrast, planktonic species remain in suspension within the water column, maximizing light utilization and facilitating biomass accumulation, which is advantageous for aquaculture scale-up (Borowitzka, 2013). Optical density at 680 nm (OD₆₈₀) is widely used as a proxy for microalgal biomass and photosynthetic activity, as it corresponds to chlorophyll a absorption in the red spectrum. This further emphasizes the performance gap between benthic and planktonic forms (Yu et al., 2022). P. oklahomense and S. elongates consistently maintained higher OD values throughout the culture period, indicating active growth and relatively stable chlorophyll content. Conversely, Amphora sp. exhibited lower OD values, highlighting the challenges of cultivating benthic diatoms in suspended systems and the necessity for specialized culture strategies (e.g., inclined surfaces, rolling tanks, continuous aeration) to optimize light exposure and biomass yield (Krishnan et al., 2025; Cheah et al., 2023).

Figure 3. Growth curve of isolated microalgae during 14 days of cultivation.

Figure 3. Growth curve of isolated microalgae during 14 days of cultivation.

In this study, measurements taken on day 14 revealed marked differences between planktonic and benthic isolates. While planktonic taxa such as Picochlorum sp., P. oklahomense, Nannochloris sp., and S. elongatus exhibited similar efficiencies, the markedly lower efficiency of Amphora sp. likely reflects methodological bias rather than poor viability (Table 5). Uneven cell distribution and shading effects caused by settled diatoms may mask actual biomass levels (Arnaldo et al., 2024; Prelle et al., 2021; Huang et al., 2019). These limitations highlight the need for alternative or complementary growth assessment methods, such as direct cell counts, in vivo chlorophyll fluorescence, or particulate organic carbon quantification, when evaluating benthic taxa.

On day 14, OD measurements of the five isolated microalgae ranged from 0.20 to 0.67, reflecting differences in adaptation and photosynthetic efficiency. Picochlorum sp. (0.67 ± 0.15), S. elongatus (0.66 ± 0.20), Nannochloris sp. (0.66 ± 0.02), and P. oklahomense (0.61 ± 0.03) showed no significant differences (P > 0.05), indicating comparable growth under the given conditions. Amphora sp., however, recorded significantly lower absorbance (0.20 ± 0.02; P < 0.05). Sedimentation at the bottom of culture vessels and cuvettes reduces light exposure and promotes cell overlap, thereby limiting photosynthetic activity. Consequently, OD-based measurements may underestimate benthic growth, and alternative methods such as direct cell counts or in vivo fluorescence are recommended (Cointet et al., 2019).

Table 5. Optical density of isolated microalgae on day 14 of cultivation.

Microalgae Day 14 (OD 680 nm)
Synechococcus elongatus 0.66 ± 0.20a
Amphora sp. 0.20 ± 0.02b
Picochlorum sp. 0.67 ± 0.15a
Nannochloris sp. 0.66 ± 0.02a
Picochlorum oklahomense 0.61 ± 0.03a

Mean optical density (OD) at 680 nm for five isolated microalgae strains, measured on Day 14 of batch culture, is presented. Values are expressed as mean ± standard deviation (n = 3). Different superscript letters indicate significant differences between groups (P < 0.05).

Beyond methodological considerations, these findings have significant implications for strain selection in aquaculture applications. Planktonic microalgae present operational advantages for large-scale cultivation due to their stable suspension in the water column, a reduced risk of photolimitation, and ease of biomass harvesting. In contrast, benthic species, while potentially valuable for specialized applications such as biofilm-based nutrient removal, may necessitate more complex culture systems to achieve comparable productivity. Therefore, culture design must align with the ecological traits of the target species to maximize yield and functional performance.

4. Conclusions

Five microalgae strains, namely Synechococcus elongatus, Amphora sp., Picochlorum sp., Nannochloris sp., and Picochlorum oklahomense, were isolated from wastewater and pond systems in a commercial shrimp farm. Green microalgae were the most common, found at multiple sites, while cyanobacteria and diatoms were limited to specific locations, likely due to site-specific environmental conditions. All strains showed measurable biomass accumulation over 14 days. Planktonic species maintained higher and more consistent OD values than the benthic diatom Amphora sp., whose lower optical readings were attributed to sedimentation effects rather than poor growth. These differences highlight the influence of morphology on culture performance: planktonic forms are better suited to suspended batch cultures, while benthic species may require modified systems to enhance light access and resuspension. The results indicate that planktonic strains, particularly Picochlorum spp., Nannochloris sp., and S. elongatus, are promising candidates for biomass production and live food applications in aquaculture, while Amphora sp. holds value in benthic or biofilm-based nutrient recovery systems. The diversity of strains recovered demonstrates the potential of aquaculture environments as reservoirs of microalgae with both functional and commercial value.

Acknowledgements

This work was carried out with financial support from the International Development Research Centre (IDRC), Canada, and the Global AMR Innovation Fund (GAMRIF), part of UK Government’s Department of Health and Social Care (DHSC) (Project no: 110342-001 Enhancing Sustainability in Shrimp Aquaculture through Microalgae-Bacteria System with Quorum Sensing Inhibition Properties).

Funding information

This work was financially supported by the Japan Science and Technology Agency (JST)/Japan International Cooperation Agency (JICA), Science and Technology Research Partnership for Sustainable Development (SATREPS) through the project for Continuous Operation System for Microalgae Production Optimised for Sustainable Tropical Aquaculture (COSMOS), and the SATREPS-COSMOS Matching Fund from the Ministry of 391 Education Malaysia (MOE).

Ethical approval statement

None to declare.

Data availability statement

Data will be made available on request.

Informed consent statement

Not applicable.

Conflict of interest

The authors declare no conflict of interest.

Author contributions

Conceptualization, methodology, formal analysis, investigation, data curation, and writing original draft preparation: Mohd Ihsanuddin Ahmad; formal analysis, investigation, methodology, and writing original draft: Ellieelisa Martine; formal analysis and writing review and editing: Hazwani Hanim Hasnan; writing review and editing: Yam Sim Khaw and Hui Teng Tan; conceptualization, project administration, supervision, visualization, funding acquisition, and writing review and editing: Ikhsan Natrah. All authors critically reviewed the manuscript and approved the final version for submission.

References

Agostino E, Macrì A, Zammuto V, D’Alessandro M, Nicolò MS, Giacobbe S and Gugliandolo C, 2024. Microbial mat dominated by Amphora spp. and their adaptive strategies in an arsenic-rich brackish pond. Journal of Marine Science and Engineering, 12(11): 1966. https://doi.org/10.3390/jmse12111966

Ahmad KAH, Mohd Hamidi NF, Zakaria MF, Ahmad A, Harun MR, Segaran TC and Jusoh M, 2024. Genetically engineered microalgae for enhanced bioactive compounds. Discover Applied Sciences, 6: 482. https://doi.org/10.1007/s42452-024-06116-5

Ahmad MI, Nazarudin MF, Hasnan HH, Baharuddin ND, Latif K, de Cruz CR, Karim M, Tan HT, Khaw YS, Lee JKC and Natrah I, 2025. Effect of Halamphora coffeaeformis supplementation in rice bran biofloc on the growth and survival of black tiger shrimp (Penaeus monodon) postlarvae. Aquaculture International, 33(2): 556. https://doi.org/10.1007/s10499-025-02245-9

Andersen RA, 2005. Algal culturing techniques. Andersen RA (Ed.). Elsevier Academic Press. pp. 592.

Arnaldo MDG, Gamage ND, Jaffrenou A, Rabesaotra V, Mossion A, Wielgosz-Collin G and Méléder V, 2024. Comparison of different small-scale cultivation methods towards the valorization of a marine benthic diatom strain for lipid production. Algal Research, 77: 103327. https://doi.org/10.1016/j.algal.2023.103327

Baharuddin ND, Muthukhrisnan S, de Cruz CR, Kassim Z, Hasnan HH, Abdullah MI, Khaw YS, Tan HT, Nazarudin MF and Natrah I, 2024. Evaluation of diatom Halamphora sp. and harpacticoid copepod Amphiascoides neglectus as live food for black tiger shrimp Penaeus monodon postlarvae. Aquaculture, 586: 740773. https://doi.org/10.1016/j.aquaculture.2024.740773

Barten R, Kleisman M, D’Ermo G, Nijveen H, Wijffels RH and Barbosa MJ, 2022. Short-term physiologic response of the green microalga Picochlorum sp. (BPE23) to supra-optimal temperature. Scientific Reports, 12: 3290. https://doi.org/10.1038/s41598-022-06954-6

Becker EW, 2007. Micro-algae as a source of protein. Biotechnology Advances, 25(2): 207–210. https://doi.org/10.1016/j.biotechadv.2006.11.002

Bellinger EG and Sigee DC, 2010. Freshwater algae: Identification and use as bioindicators. Bellinger EG and Sigee DC (Eds.). John Wiley & Sons Ltd. pp. 284. https://doi.org/10.1002/9780470689554

Borics G, Abonyi A, Salmaso N and Ptacnik R, 2021. Freshwater phytoplankton diversity: models, drivers and implications for ecosystem properties. Hydrobiologia, 848: 53–75. https://doi.org/10.1007/s10750-020-04332-9

Borowitzka MA, 2013. High-value products from microalgae—their development and commercialization. Journal of Applied Phycology, 25(3): 743–756. https://doi.org/10.1007/s10811-013-9983-9

Brown MR, Jeffrey SW, Volkman JK and Dunstan GA, 1997. Nutritional properties of microalgae for mariculture. Aquaculture, 151(1–4): 315–331. https://doi.org/10.1016/S0044-8486(96)01501-3

Brumfield KD, Chen AJ, Gangwar M, Usmani M, Hasan NA, Jutla AS, Huq A and Colwell RR, 2023. Environmental factors influencing occurrence of Vibrio parahaemolyticus and Vibrio vulnificus. Applied and Environmental Microbiology, 89(6): e00307-23. https://doi.org/10.1128/aem.00307-23

Cheah YT, Ng BW, Tan TL, Chia ZS and Chan DJC, 2023. Biomass and eicosapentaenoic acid production from Amphora sp. under different environmental and nutritional conditions. Biotechnology and Applied Biochemistry, 70(2): 568–580. https://doi.org/10.1002/bab.2379

Chin YK, Azzam-Sayuti M, Mohamad A, Haifa-Haryani WO, Ahmad MI, Nazarudin MF, Mohd Ali NS, Ida-Muryany MY, Abd Karim MM, Annas S, Nor MN, Amal MNA and Ina-Salwany MY, 2025. Elucidation of synbiotic diet comprising Lactobacillus plantarum L20 and Sargassum polycystum on gastrointestinal microbiota, tissue structures and AHPND associated dysbiosis susceptibility in black tiger shrimp (Penaeus monodon). Aquaculture, 594: 741339. https://doi.org/10.1016/j.aquaculture.2024.741339

Cointet E, Wielgosz-Collin G, Bougaran G, Rabesaotra V, Gonçalves O and Méléder V, 2019. Effects of light and nitrogen availability on photosynthetic efficiency and fatty acid content of three original benthic diatom strains. PLoS One, 14(11): e0224701. https://doi.org/10.1371/journal.pone.0224701

Couto AT, Cardador M, Santorio S, Arregui L, Sicuro B, Mosquera-Corral A, Castro PML and Amorim CL, 2022. Cultivable microalgae diversity from a freshwater aquaculture filtering system and its potential for polishing aquaculture-derived water streams. Journal of Applied Microbiology, 132(2): 1543–1556. https://doi.org/10.1111/jam.15300

Dao TS, Nguyen DAK, Nguyen VT, Huu HH, Nguyen TD, Pham TL, Tran PYN and Luu TTN, 2024. Salinity tolerance and nutrient uptake of the freshwater microalga Scenedesmus protuberans. Case Studies in Chemical and Environmental Engineering, 10: 100803. https://doi.org/10.1016/j.cscee.2024.100803

Day JG, Thomas NJ and Achilles-Day UEM, 2012. Freshwater and marine microalgae: Maintenance of cultures. In: Stein JR (Ed.), Handbook of Phycological Methods: Culture Methods and Growth Measurements (pp. 53–68). Cambridge University Press.

Fernandes T and Cordeiro N, 2021. Microalgae as sustainable biofactories to produce high-value lipids: Biodiversity, exploitation, and biotechnological applications. Marine Drugs, 19(10): 573. https://doi.org/10.3390/md19100573

Foflonker F, Mollegard D, Ong M, Yoon HS and Bhattacharya D, 2018. Genomic analysis of Picochlorum species reveals how microalgae may adapt to variable environments. Molecular Biology and Evolution, 35(11): 2702–2711. https://doi.org/10.1093/molbev/msy167

Fuß T, Bistarelli LT, Ptacnik R and Singer GA, 2025. Niche partitioning in a periphyton metacommunity peaks at intermediate species richness in midsized rivers. Ecology, 106: e4524. https://doi.org/10.1002/ecy.4524

Guillard RRL, 2005. Purification methods for microalgae. In: Andersen RA (Ed.), Algal Culturing Techniques (pp. 117–132). Elsevier Academic Press. https://doi.org/10.1016/B978-012088426-1/50009-3

Han P, Lu Q, Fan L and Zhou W, 2019. A review on the use of microalgae for sustainable aquaculture. Applied Sciences, 9(11): 2377. https://doi.org/10.3390/app9112377

Hotos GN, Papadakis G and Fokiali S, 2021. Effect of various salinities and light intensities on growth and biomass yield of microalgae species: Implications for aquaculture applications. Journal of Marine Science and Engineering, 9(11): 1275. https://doi.org/10.3390/jmse9111275

Huang J, Hankamer B and Yarnold J, 2019. Design scenarios of outdoor arrayed cylindrical photobioreactors for microalgae cultivation considering solar radiation and temperature. Algal Research, 41: 101515. https://doi.org/10.1016/j.algal.2019.101515

Iyer A, Monissen M, Ma Q, Osborne M, Schaedig E, Modin O and Halim R, 2025. Axenisation of oleaginous microalgal cultures via anoxic photosensitisation. Algal Research, 86: 103926. https://doi.org/10.1016/j.algal.2025.103926

Jiang Q, Chen J, Yang C, Yin Y and Yao K, 2019. Quorum sensing: A prospective therapeutic target for bacterial diseases. BioMed Research International, 2019: 2015978. https://doi.org/10.1155/2019/2015978

John DM, Whitton BA and Brook AJ, 2011. Introduction. In: John DM, Whitton BA and Brook AJ (Eds.), The Freshwater Algal Flora of the British Isles: An Identification Guide to Freshwater and Terrestrial Algae (pp. 1–5). Cambridge University Press.  https://doi.org/10.1017/CHOL9781108784122

Komárek J and Fott P, 1983. Chlorophyceae (Grünalgen), Ordnung: Chlorococcales. In: Huber-Pestalozzi G (Ed.), Das Phytoplankton des Süßwassers: Systematik und Biologie (pp. 1–1044). E. Schweizerbart’sche Verlagsbuchhandlung (Nägele & Obermiller).

Kooistra WHCF, Sarno D, Balzano S, Gu H, Andersen RA and Zingone A, 2008. Global diversity and biogeography of Skeletonema species (Bacillariophyta). Protist, 159(2): 177–193. https://doi.org/10.1016/j.protis.2007.09.004

Krishnan A, Barry AN, Glenn C, Sayre RT and Mayfield SP, 2021. Picochlorum celeri as a model system for robust outdoor microalgae cultivation under high temperature and salinity. Scientific Reports, 11: 18407. https://doi.org/10.1038/s41598-021-91106-5

Krishnan A, Dahlin LR, Guarnieri MT, Weissman JC and Posewitz MC, 2025. Small cells with big photosynthetic productivities: Biotechnological potential of the Picochlorum genus. Trends in Biotechnology, 43(4): 759–772. https://doi.org/10.1016/j.tibtech.2024.10.004

Kupriyanova EV, Shishova MF and Kuznetsov AV, 2024. The freshwater cyanobacterium Synechococcus elongatus and its responses to hydrochemical fluctuations: Implications for productivity and ecosystem functioning. Plants, 13(16): 2323. https://doi.org/10.3390/plants13162323

Ma M and Hu Q, 2024. Microalgae as feed sources and feed additives for sustainable aquaculture: Prospects and challenges. Reviews in Aquaculture, 16(2): 818–835. https://doi.org/10.1111/raq.12869

Meng W, Xia M, Hu J, Wang C, Qian C, Zhang M and Fu W, 2025. Adaptation and synthetic biology of the model cyanobacterium Synechococcus elongatus for sustainable development: A review. Frontiers in Marine Science, 12: 1542670. https://doi.org/10.3389/fmars.2025.1542670

Michels MHA, 2015. Microalgae for aquaculture. PhD thesis, Graduate School VLAG (Advanced studies in Food Technology, Agrobiotechnology, Nutrition and Health Sciences). Wageningen University, Droevendaalsesteeg 2, 6708 PB Wageningen, The Netherlands. pp. 158. https://library.wur.nl/WebQuery/wda/2087572

Mills LA, Moreno-Cabezuelo JÁ, Włodarczyk A, Victoria AJ, Mejías R, Nenninger A, Moxon S, Bombelli P, Selão TT, McCormick AJ and Lea-Smith DJ, 2022. Development of a biotechnology platform for the fast-growing cyanobacterium Synechococcus sp. PCC 11901. Biomolecules, 12(7): 872. https://doi.org/10.3390/biom12070872

Natrah FMI, Kenmegne MM, Wiyoto W, Sorgeloos P, Bossier P and Defoirdt T, 2011. Effects of micro-algae commonly used in aquaculture on acyl-homoserine lactone quorum sensing. Aquaculture, 317: 53–57. https://doi.org/10.1016/j.aquaculture.2011.04.038

Nazarudin MF, Zulkiply MAF, Samsuri MH, Khairil Anwar NAS, Jamal NSA, Alipiah NM, Ahmad MI, Nor NM, Yasin ISM, Ikhsan N, Azmai MNA and Rosli MH, 2025. Optimizing shrimp culture through environmental monitoring: Effects of water quality and metal ion profile on whiteleg shrimp (Litopenaeus vannamei) performance in a semi-intensive culture pond. Water, 17(19): 2818. https://doi.org/10.3390/w17192818

Orefice I, Musella M, Smerilli A, Sansone C, Corato F and Brunet C, 2019. Role of nutrient concentrations and water movement on diatom’s productivity in culture. Scientific Reports, 9: 1479. https://doi.org/10.1038/s41598-018-37611-6

Pragthong P, Chirapongsatonkul N and U-taynapun K, 2020. Temperature-dependent expression of virulence genes in Vibrio parahaemolyticus AHPND strain (VpAHPND). International Journal of Agricultural Technology, 16(5): 1185–1198.

Prelle LR, Albrecht M, Karsten U, Damer P, Giese T, Jähns J, Müller S, Schulz L, Viertel L and Glaser K, 2021. Ecophysiological and cell biological traits of benthic diatoms from coastal wetlands of the southern Baltic Sea. Frontiers in Microbiology, 12: 642811. https://doi.org/10.3389/fmicb.2021.642811

Ruppert EE, Fox RS and Barnes RD, 2004. Invertebrate zoology: A functional evolutionary approach. Ruppert EE, Fox RS and Barnes RD (Eds.). Thomson Brooks/Cole. pp. 963.

Saccardo A, Wolf J, Bezzo F and Hankamer B, 2024. Modelling dynamics of photosynthetic units and microalgae growth based on high throughput pulsed light screens. Chemical Engineering Journal, 490: 151684. https://doi.org/10.1016/j.cej.2024.151684

Safi C, Zebib B, Merah O, Pontalier PY and Vaca-Garcia C, 2014. Morphology, composition, production, processing and applications of Chlorella vulgaris: A review. Renewable and Sustainable Energy Reviews, 35: 265–278. https://doi.org/10.1016/j.rser.2014.04.007

Saleem A, Anwar S, Saud S, Kamal T, Fahad S and Nawaz T, 2025. Cyanobacteria diversity and ecological roles: Insights into primary production and nutrient cycling in aquatic environments. Journal of Umm Al-Qura University for Applied Sciences, 2025: 1-19. https://doi.org/10.1007/s43994-025-00261-2

Sarıtaş S, Kalkan AE, Yılmaz K, Gurdal S, Göksan T, Witkowska AM, Lombardo M and Karav S, 2025. Biological and nutritional applications of microalgae. Nutrients, 17: 93. https://doi.org/10.3390/nu17010093

Shen J, Zheng X, Liu M, Xu K, He L and Lin Z, 2024. Targeted cultivation of diatoms in mariculture wastewater by nutrient regulation and UV-C irradiation. Frontiers in Microbiology, 15: 1371855. https://doi.org/10.3389/fmicb.2024.1371855

Stein JR, 1973. Handbook of phycological methods: Culture methods and growth measurements. Stein JR (Ed.). Cambridge University Press. pp. 472.

Torzillo G and Vonshak A, 2013. Environmental stress physiology with reference to mass cultures. In: Richmond A and Hu Q (Eds.), Handbook of Microalgal Culture: Applied Phycology and Biotechnology (pp. 90–113). Wiley-Blackwell. https://doi.org/10.1002/9781118567166.ch6

Vance DJ and Rothlisberg PC, 2020. The biology and ecology of the banana prawns: Penaeus merguiensis de Man and P. indicus H. Milne Edwards. Advances in Marine Biology, 86: 1–139. Academic Press. https://doi.org/10.1016/bs.amb.2020.04.001

Walne PR, 1970. Present problems in the culture of the larvae of Ostrea edulis. Helgoländer wissenschaftliche Meeresuntersuchungen, 20: 514–525. https://doi.org/10.1007/BF01609926

Yu H, Kim J, Rhee C, Shin J, Shin SG and Lee C, 2022. Effects of different pH control strategies on microalgae cultivation and nutrient removal from anaerobic digestion effluent. Microorganisms, 10(2): 357. https://doi.org/10.3390/microorganisms10020357

Zheng J, Sun Z, Guo R, Wang R, Jin D, Hu J, Xing X, Tong M and Wang P, 2026. High-throughput and rapid classification on harmful algal bloom species based on mega image database and artificial intelligence. Marine Pollution Bulletin, 224: 119170. https://doi.org/10.1016/j.marpolbul.2025.119170

Zhou S, Li W and He S, 2023. Microalgal diversity enhances water purification efficiency in experimental microcosms. Frontiers in Ecology and Evolution, 11: 1125743. https://doi.org/10.3389/fevo.2023.1125743

How to cite

Ahmad MI, Martine E, Hasnan HH, Tan HT, Khaw YS and Natrah I, 2026.  Characterization of indigenous planktonic and benthic microalgae from Malaysian shrimp farm. Journal of Aquatic Research and Sustainability, 3(1): 9-15. https://doi.org/10.69517/jars.2026.03.01.0003

CrossMark Update
Crossmark
Article Metrics
[stm-calc id="1576"]